Access the full text.
Sign up today, get DeepDyve free for 14 days.
C. Perrins (1978)
Birds of the Western PalearcticNature, 272
H. Ellegren (1996)
First gene on the avian W chromosome (CHD) provides a tag for universal sexing of non-ratite birds.Proceedings. Biological sciences, 263 1377
Natalia Bello, O. Francino, A. Sánchez (2001)
Isolation of Genomic DNA from FeathersJournal of Veterinary Diagnostic Investigation, 13
J. Ewen, P. Cassey, A. Møller (2004)
Facultative primary sex ratio variation: a lack of evidence in birds?Proceedings of the Royal Society of London. Series B: Biological Sciences, 271
(2006)
Sex Identifi cation of the Black-faced Spoonbill
M. Nesje, K. Røed (2004)
Sex identification in falcons using microsatellite DNA markers.Hereditas, 132 3
(1997)
A CHD 1 gene is Z chromosome linked in the chicken Gallus domesticus
S. Gasca, B. Boizet-Bonhoure, F. Poulat, P. Berta (2003)
[Sex determination in mammals: a traffic update?].Medecine sciences : M/S, 19 1
R. Griffiths, M. Double, Kate Orr, R. Dawson (1998)
A DNA test to sex most birdsMolecular Ecology, 7
I. Szatkowska, S. Zych, H. Kulig (2003)
Determinacja płci u ssakÓwMedycyna Weterynaryjna, 59
(2001)
A comparison of fi ve methods
(2000)
European Blackbird Turdus merula in north-western Poland. Acta Ornithol
Richard Griffiths, B. Tiwari (1995)
Sex of the last wild Spix's macawNature, 375
R. Magrath (1989)
Hatching asynchrony and reproductive success in the blackbirdNature, 339
Hideyuki Ito, Akiko Sudo-Yamaji, Motoko Abe, T. Murase, T. Tsubota (2003)
Sex Identification by Alternative Polymerase Chain Reaction Methods in Falconiformes, 20
R. Magrath (1991)
Nestling weight and juvenile survival in the Blackbird, Turdus merulaJournal of Animal Ecology, 60
I. Newton (2004)
The recent declines of farmland bird populations in britain : An appraisal of causal factors and conservation actionsIbis, 146
D. Wysocki (2004)
Within-season divorce rate in an urban population of Europan blackbird Turdus merulaArdea, 92
A. Fridolfsson, H. Ellegren (1999)
A simple and universal method for molecular sexing of non-ratite birdsJournal of Avian Biology, 30
D. Eason, G. Millar, A. Cree, J. Halverson, D. Lambert (2001)
A comparison of five methods for assignment of sex in the takahe (Aves: Porphyrio mantelli)Journal of Zoology, 253
H. Ellegren, B. Sheldon (1997)
New tools for sex identification and the study of sex allocation in birds.Trends in ecology & evolution, 12 7
(2002)
Sex identification in monomorphic birds – a review
Zheng Zhang, S. Schwartz, L. Wagner, W. Miller (2000)
A Greedy Algorithm for Aligning DNA SequencesJournal of computational biology : a journal of computational molecular cell biology, 7 1-2
Yeong-Hsiang Cheng, T. Kuo, Der-Nan Lee, C. Weng (2006)
Sex Identification of the Black-faced Spoonbill (Platalea minor)Zoological Studies, 45
Richard Griffiths, Richard Korn (1997)
A CHD1 gene is Z chromosome linked in the chicken Gallus domesticus.Gene, 197 1-2
D. Wysocki (2006)
Factors Affecting the Between-Season Divorce Rate in the Urban Populations of the European Blackbird Turdus merula in North-Western Poland, 41
(2000)
Sex identifi cation in falcons using microsatellite DNA markers
D. Dawson, S. Darby, F. Hunter, A. Krupa, I. Jones, T. Burke (2001)
A critique of avian CHD-based molecular sexing protocols illustrated by a Z-chromosome polymorphism detected in aukletsMolecular Ecology Notes, 1
H. Ellegren, Ariane Carmichael (2001)
Multiple and independent cessation of recombination between avian sex chromosomes.Genetics, 158 1
Turdus merula is one of most common bird species in Europe. This study verified a method for its sex identification by PCR with P2/P8 primers, based on the CHD1 gene polymorphism, proposed in earlier studies as a universal tool for sex identification in most bird species. Although there are some reports that PCR cannot determine sex in Eurasian blackbirds due to a lack of differences in intron lengths of CHD1-Z and CHD1-W genes, our study showed that such a possibility does exist, so it can contribute to an increased understanding of the biology of this species. Keywords: CHD1, PCR, molecular sexing, blackbird, Turdus merula INTRODUCTION In most bird species, morphology-based sexing of chicks is impossible due to their weak sexual dimorphism. This considerably hinders some basic research, e.g. analyses of the adaptive adjustment of the primary sex ratio one of the most important problems in evolutionary biology over recent years. It is also an obstacle in the threatened species re-introduction programs (Ewen et al. 2004; Cheng et al. 2006). Similar to mammals (Szat kowska et al. 2003), the process of sex determination and differentiation in birds is controlled by a complex molecular mechanism, which eventually leads to the development of gonads and reproductive tracts, consistent with the chromosomal sex. However, unlike mammals, bird females are heterogametic (ZW), while males are homogametic (ZZ). The functions of many autosomal genes involved in the process of sex determination in birds have been mapped and described (Sf1, Wt1, Sox9, Amh, Dax1), but the identification and role of genes linked to sex chromosomes in this complex process have not been determined in detail (ellegren & cArmichAel 2001). A bird's sex can be identified in many ways, but in monomorphic species, or young individuals, molecular techniques may provide substantial support (sAchArcZuk et al. 2002). In the W chromosome there are several genes, but only the CHD1 gene (which encodes chromodomain-helicase-DNA-binding protein 1) has been applied to sex identification. This is due to the fact that the CHD1 gene, mapped in the W chromosome (W-linked), has a homologous copy also in the Z chromosome (Z-linked) (griffiths & korn 1997). Although both variants are extremely conservative (griffiths & korn 1997; ellegren & cArmichAel 2001), they can still differ with regard to the length of their intron sequences (depending on species), enabling differentiation between the copies from the W/Z chromosomes. A test using the extremely conservative gene CHD can be a universal tool of sex identification for almost all bird classes, except for the ratites, in which the intron lengths of the CHD-W and CHD-Z genes are identical (ellegren 1996; griffiths et al. 1998). Turdus merula is one of most common bird species in Europe. Its range covers most of Europe (except its northern and northeastern fringes), North Africa, and Central Asia as far as China. Populations introduced by man also occur in Australia and New Zealand (crAmP & simmons 1988). Originally, the species was connected with broadleaf and mixed forests, but since the mid-19th century it began to colonize the cities of Western Europe. At present, this process progresses towards the north-east (mulsoW & tomiAloJ 1997). Numbers in the examined populations in most areas are stable (neWton 2004). Due to the presence of high-density urban populations, the distinct sexual dimorphism of adult individuals (brown female and black male), and the nests built at relatively small heights (crAmP & simmons 1988), the Eurasian blackbird is the most often examined bird species building open nests in Europe, so it often serves as a model for other species (mAgrAth 1989; mAgrAth 1991; Wysocki 2004; Wysocki 2006). Although in adult individuals sex can be identified based on plumage colour, alternative methods are necessary in chicks, and all the more in dead embryos. Criteria used in choosing alternative methods of sex identification should take into account several significant issues, but first of all, the method should be as noninvasive as possible. Diagnostic tests based on DNA analysis are exactly that, because DNA can be obtained from a single feather or a drop of blood (ito et al. 2003). Moreover, once obtained, blood or tissue samples, regardless of the age of the examined birds, can be kept for long periods of time and used many times in later analyses (eAson et al. 2001). It is also possible to isolate DNA from feathers cast down during moulting, which makes it easy to identify the sex of very rare, threatened, or the last free-living birds of a species. The aim of this study was to evaluate the applicability of PCR in sex determination of Eurasian blackbirds (Turdus merula), on the basis of the polymorphism of the CHD1 gene and using the primer sequences proposed previously for sex identification in other bird species. SEX IDENTIFICATION IN EURASIAN BLACKBIRDS MATERIALS AND METHODS The research involved 99 blackbird nestlings, living in city parks in Szczecin (NW Poland). DNA was isolated from quills (Bello et al. 2001). The sex of the birds was identified using PCR with the P2/P8 primers (griffiths et al. 1998). The PCR mixture contained a buffer for Taq polymerase (50 mM KCl, 10 mM Tris-HCl, 0.01% TritonTMX-100, 1.5 mM MgCl2), 0.2 mM dNTP, 10 pmol of each primer, 0.4 units of Taq-polymerase (MBI Fermentas), 50 ng of genomic DNA, and up to 15 l of deionized water. The PCR was carried out in T-personal (Biometra) and GeneAmp PCR System 2400 (Perkin Elmer) thermocyclers under the following thermal conditions: initial denaturation of DNA at 94°C for 5 min, and in the subsequent 33 cycles at 94°C for 1 min, annealing of primers at 54°C for 1 min, DNA synthesis at 72°C for 1 min, and the final elongation cycle at 72°C for 5 min. The applied temperature for primer annealing was higher than in the original method in order to eliminate unspecific products. Amplification products were separated by horizontal electrophoresis (90 V, 50 min) in 3% agarose gels (PRONA) in 1×TBE and 0.5 µM ethidium bromide. The results of electrophoresis were read under UV light (312 nm). To determine the DNA sequences of CHD1-Z and CHD1-W, specific amplicons (bands) were isolated from agarose gels by using DNA Gel-Out (A&A Biotechnology), sequenced in an ABI Prism Sequencer (Perkin-Elmer), and analyzed using Chromas 2.31 software. The sequencing was done at the Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland. The obtained results were analyzed using BLAST software (ZhAng et al. 2000). RESULTS The applied P2/P8 primers, according to griffiths et al. (1998), enabled an effective and specific amplification of a selected region of the CHD1-W gene and its homologous copy CHD1-Z. PCR products were 394/349 bp in length (CHD1-W/ CHD1-Z). In order to confirm the amplification specificity and identify differences in the lengths of introns in the 2 genes, we sequenced the obtained PCR products. Our results were compared with GenBank data (BLAST). Analysis of the amplified exon sequences (152 bp) confirmed that the sequences of PCR products obtained in this study (deposited in GenBank, DQ517890 and DQ517891) were fragments of the CHD1-Z and CHD1-W genes. Moreover, the homology was determined with analogous exon sequences of other bird species (Table 1). The polymorphic variants of the CHD1-W and CHD1-Z genes obtained in this study resulted from the variable length of the amplified introns. These sequences were compared and deletion sites were presented in the sequence of CHD1-Z (Figure 1), which was shorter than that of CDH1-W by about 45 bp. Accordingly, the electrophoretic image revealed a single amplicon in the homogametic males (ZZ), and 2 amplicons in females (ZW) (Figure 2). In the examined population of 99 ringed blackbird nestlings, we molecularly identified 58 females and 41 males, and the results were verified in the following breeding season, on the basis of the plumage colouration of adult individuals already Table 1. Comparison of CHD1 exon sequences of Turdus merula with those of other species, based on GenBank accessions Accession number of Turdus merula CHD1 CHD1-Z, DQ517891 CHD1-W, DQ517890 Species Taeniopygia guttata (zebra finch) Parus caeruleus (blue tit) Accession number of its CHD1 AF006661 AM180351 Identity (%) 98 97 Z ttggttgtagttctgtgttgcttttggtgtagtttg...ttgctttttggggtttgggttttttt.. W ctgggtgtgactgagtactgattttgttgttgttattatttggattttttattgcagttgttctggc Z tt..ccttttctggaacata.tttttttgaca.g.agt.aggt.aga......attt.......gct W ttgtacttttgggttgggtggttttcatgtgtggcacccacaccacccccctcatttttgacaggct Z ......tatatt.......tgttacttaca.t.ggctt...c..cttgctctggaattccag W agacagcatattaataaaatatttagtcatgtagctttgaactacttcatctgaaattccag Fig. 1. Comparison of intron sequences of Turdus merula CHD1-Z and CHD1-W genes (DQ517891, DQ517890). Identical nucleotides are printed in bold; deletion sites (i.e. absence in CHD1-W) are marked with dots having a distinct sexual dimorphism. There was 100% consistency between the molecular analyses and the later observation of plumage. DISCUSSION When the W chromosome was found to be characteristic only for females of birds, it became an interesting model not only in the search for specific genes involved in the process of sex determination in birds, but also in the identification of a possible variance that could differentiate between the heterochromosomes W and Z (nesJe & red 2000). The first primers (P2 and P3), proposed by griffiths & tiWAri (1995), amplified the exon of both copies of the CHD1 gene, and the obtained PCR products differed only slightly with regard to the length of the sequence, which ranged from 60 to 110 bp, depending on species (ellegren & sheldon 1997). Consequently, griffiths et al. (1998) proposed to use P2/P8 primers, enabling the amplification of short coding sections of both gene copies (CHD1-W and CDH1-Z) and an intervening intron, variable with respect to its sequence and length. Thanks to the fact that this gene appears in both heterochromosomes, the PCR product will be ever-present, which excludes false negative results. SEX IDENTIFICATION IN EURASIAN BLACKBIRDS Fig. 2. Representative results of PCR analysis. M = pUC19/MspI (MBI Fermentas) Differences in the lengths of amplicons, specific for the CHD1-Z and CHD1-W genes, resulted in this study from different lengths of the intron sequence, but the precise determination of the entire intron length in the CHD1-W gene, based on sequencing results using P2/P8, proved to be difficult. Nonetheless, given the migration rate of the longer amplicon in agarose gel, the length of the homologous intron sequence of the CHD1-W gene in Hemispingus frontalis (206 bp) and Taeniopygia guttata (208 bp), and the fact that the analogous intron of the CHD1-Z copy was 168 bp long, with deletions of 45 bp, it can be supposed that the full intron sequence of the gene CHD1-W in Eurasian blackbirds should have a length of 213 bp. Fridolfsson & Ellegren (1999) proposed another pair of primers useful in sexing protocols (2550F/2718R). In Eurasian blackbirds, however, the 2550F/2718R primers amplified a single identical product in both sexes (dAWson et al. 2001). The PCR technique using P2/P8 primers appears to be a better method of sex identification in passerines. Our study shows that it is useful for sex identification in blackbirds, so it can contribute to an increased understanding of biology of this species.
Biological Letters – de Gruyter
Published: Jan 1, 2009
You can share this free article with as many people as you like with the url below! We hope you enjoy this feature!
Read and print from thousands of top scholarly journals.
Already have an account? Log in
Bookmark this article. You can see your Bookmarks on your DeepDyve Library.
To save an article, log in first, or sign up for a DeepDyve account if you don’t already have one.
Copy and paste the desired citation format or use the link below to download a file formatted for EndNote
Access the full text.
Sign up today, get DeepDyve free for 14 days.
All DeepDyve websites use cookies to improve your online experience. They were placed on your computer when you launched this website. You can change your cookie settings through your browser.