Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Characterization of genes for histone H3, 18S rRNA, and cytochrome oxidase subunit I of East Asian mayflies (Ephemeroptera)

Characterization of genes for histone H3, 18S rRNA, and cytochrome oxidase subunit I of East... We have determined nucleotide sequences of three genes encoding histone H3, 18S rRNA, and mitochondrial cytochrome oxidase subunit I (COI) from the mayfly community in Eastern Asia. All sequence data collected from 303 specimens comprising 80 taxa (63 identified to species, 14 to genus, and 3 to family) were deposited in GenBank/ EMBL/ DDBJ International Databases for further expansion of DNA barcoding projects of mayflies. Phylogenetic analysis based on the neighborjoining method among the three genes found that COI and H3 genes had relatively high evolutionary rates, and were not suitable in inferring phylogenetic relationships among Article note: N. Shimizu, who designed the work and was responsible for DNA sequencing, passed away on June 5, 2015, after his approval for submitting the manuscript on May 26, 2015. This paper is dedicated to him. *Corresponding author Mikio Kato, Biology Laboratory, Faculty of Liberal Arts and Sciences, Osaka Prefecture University, 1-1 Gakuencho, Naka-ku, Sakai 599-8531, Japan, E-mail: mkato@b.s.osakafu-u.ac.jp Kei Wakimura, Biology Laboratory, Faculty of Liberal Arts and Sciences, Osaka Prefecture University, 1-1 Gakuencho, Naka-ku, Sakai 599-8531, Japan Yasuhiro Takemon, Disaster Prevention Research Institute, Kyoto University, Uji 611-0011, Japan Atsushi Takayanagi, Nobuyoshi Shimizu, Advanced Research Center for Genome Super Power, Keio University, 2 Ohkubo, Tsukuba 3002611, Japan Shin-ichi Ishiwata, Department of Applied Chemistry, Kanagawa Institute of Technology, 1030 Shimo-Ogino, Atsugi 243-0292, Japan Kozo Watanabe, Department of Civil and Environmental Engineering, Ehime University, Bunkyo-cho 3, Matsuyama 790-8577, Japan Kazumi Tanida, Mikio Kato, Department of Biological Sciences, Graduate School of Science, Osaka Prefecture University, 1-1 Gakuencho, Naka-ku, Sakai 599-8531, Japan # Present address: Osaka Museum of Natural History, Nagai Park, Higashi-sumiyoshi, Osaka, 546-0034, Japan families within the orders but were useful in identifying species (i.e., DNA barcoding). In contrast, the more conserved 18S rRNA gene was adequately informative for elucidating inter-family divergence, but not suitable for species identification. Keywords: COI; gene phylogeny; histone; mayfly; rRNA; species identification 1 Introduction Aquatic insects comprise a taxonomically diverse community in rivers. Some taxonomic groups (taxa) are used as indicators for monitoring ecosystem health [1]. Despite their ecological importance, some groups (e.g., mayflies, Ephemeroptera) are often neglected in identification at the species-level in routine ecological assessments, and even in detailed research projects. Mayflies serve as indicators for ecological integrity because they are sensitive to environmental conditions such as water quality and flow characteristics [2-4]. Because of their small size, high abundance, diversity, and complex taxonomy, even experienced taxonomists find difficulty in species identification, especially when handling immature stages or damaged specimens. As an alternative to the classical identification based on morphological characters, DNA-based identification had been proposed [5] and DNA barcoding (originally proposed by Hebert et al. [6]) has become standard for characterizing a variety of taxonomic groups including mayflies. DNA barcoding uses a matching analysis of a short genetic marker (DNA barcode) to DNA databases of identified specimens. The utility and reliability of DNA barcoding depend upon the quality of DNA databases in which the annotated sequence data are registered. While 142 species of Japanese mayflies have been described from 39 genera in 13 families [7], only 17 species in 8 families of © 2016 Kei Wakimura, et al., published by De Gruyter Open. This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivs 3.0 License. K. Wakimura, et al. Japanese mayflies' DNA sequences appeared in GenBank/ EMBL/ DDBJ International DNA databases (http://www. ncbi.nlm.nih.gov/genbank/) when searched by the terms "Ephemeroptera" + "Japan" + NOT "Osaka Prefecture" (accessed 25 May, 2015). To accelerate DNA barcoding in surveying the mayfly biodiversity in the East Asian area, more annotated sequences must be registered to the databases. The present work aims to collect molecular data of East Asian mayflies from three genes that are widely used for taxonomic and evolutionary studies; a 658-bp partial coding region of cytochrome oxidase subunit I (COI) as suggested by Consortium for the Barcode of Life (CBOL, http://www.barcodeoflife.org/), a 328-bp partial coding region of histone 3 (H3), and a partial sequence of 18S rRNA (about 550-bp). All genes have been utilized to deduce the phylogenetic relationship among Ephemeroptera species [8]. For 18S rRNA, we chose the target region covering V4 and V5 stem-loop structures because of their high level of genetic variation within the order Ephemeroptera [9]. specimens, followed by a conventional proteinase-phenol extraction protocol [10]. Genitalia and heads parts were kept intact during dissection as voucher specimens, and stored in absolute ethanol. However, the genitalium of some small specimens was damaged during the isolation of sperm vesicles. For a few small specimens (e.g., Baetidae), a whole body was mashed in a micro-centrifuge tube prior to DNA extraction. All the information about the samples such as developmental stage, sex, date of collection, locality, by whom collected and identified, source organ for DNA isolation, and raw data of DNA sequencing were recorded. These are available from the corresponding author (Kato) upon request. DNA samples were stored in the refrigerator and insect specimens were kept at room temperature in absolute ethanol. All the samples used in this study are safely kept in the corresponding author's laboratory (Osaka Prefecture University) except those safely stored in Takemon's laboratory (Kyoto University) (specimen vouchers KU_Rj2008-60 ~ 69). 2 Materials and methods 2.1 Sample specimens We collected 303 specimens (109 imagoes, 148 nymphs, 46 subimagoes) from 80 taxa which were composed of 63 species, 14 genera (unidentified specific name), and 3 families (unidentified genus name) for sequencing analysis (Table 1). In total, there were 33 genera belonging to 11 families. These samples were collected from Honshu, Kyushu and Ryukyu Islands of Japan and Taiwan in the years of 1997-2014. Specimens were identified by the authors before DNA extraction. To avoid false-positive identification in DNA barcoding, only accurately identified specimens must be registered with full scientific names in the DNA databases. Therefore, taking a conservative approach, we did not assign scientific names to the specimens that could not be identified unambiguously due to damage or their early developmental stages. Fresh specimens were dissected to isolate DNA samples, while some were stored at -80°C, or in absolute ethanol at room temperature until the time of dissection. DNA was extracted from wing muscles at mid-thorax (imago/subimago females and males), sperm vesicles (imago/subimago males), hemolymph containing several types of somatic cells (nymphs), whole thorax (small individuals), or legs (relatively large individuals) of the 2.2 DNA analyses PCR was performed using a set of DNA primers designed for amplifying the target genes (Table 2), with either Sensizyme® HotStart Taq Premix (RBC Bioscience) or AmpliTaq Gold® 360 Master Mix (Life Technologies), depending on the availability. Amplified DNA fragments were purified using HiYieldTM Gel/PCR DNA Fragments Extraction Kit (RBC Bioscience) and sequenced from both forward and reverse directions using BigDye® Terminator v3.1 (Life Technologies) and an ABI3730xl DNA Analyzer (Applied Biosystems - Life Technologies). Forward and reverse sequencing reads were assembled, and aligned using BioEdit Sequence Alignment Editor version 7.1.3.0 [11]. Phylogenetic trees for each of the three genes were reconstructed based on the neighbor-joining method [12] using "Dnadist" with the option F84 model and "Neighbor" implemented in PHYLIP [13] with outgroup sequences (accession numbers: KC135891 for COI, AY870292 for histone H3, EF680326 for 18S rRNA). Tree topologies were examined by bootstrapping sequences of 1000 pseudoreplicates using "Seqboot" in PHYLIP. For the tree reconstructions, we used only sequence data that has a complete set of the three genes for simple comparison of tree topologies among different genes. Incomplete data sets (i.e., specimens of which only one or two genes out of three were determined) were not incorporated to the analysis. Table 1. Accession numbers of sequence data and source information. Stage imago imago imago nymph nymph nymph nymph nymph nymph nymph nymph imago imago imago nymph imago imago imago nymph nymph imago imago imago imago nymph nymph nymph nymph hemolymph hemolymph whole body hemolymph sperm vesicles sperm vesicles sperm vesicles sperm vesicles Nara, Japan Nara, Japan Nara, Japan Nara, Japan Okinawa, Japan Okinawa, Japan Okinawa, Japan Wakayama, Japan whole body Wakayama, Japan whole body Wakayama, Japan sperm vesicles Nara, Japan sperm vesicles Wakayama, Japan sperm vesicles Wakayama, Japan 26 Apr, 2009 26 Apr, 2009 26 Apr, 2009 5 May, 2012 5 May, 2012 8 May, 2010 8 May, 2010 27 Apr, 2013 27 Apr, 2013 23 Apr, 2012 23 Apr, 2012 23 Apr, 2012 15 May, 2011 KP970774 KP970775 KF562927 KF562928 KF562929 KP970811 JQ650162 wing muscle Wakayama, Japan 5 May, 2012 wing muscle Wakayama, Japan 5 May, 2012 wing muscle Nara, Japan 14 Apr, 2011 wing muscle Nara, Japan 14 Apr, 2011 JQ650183 JQ650184 KF562908 KF562938 GU354156 GU354157 GU354158 KF562941 KF562942 JQ650206 JQ650147 KF563003 KF563004 GU354162 KF563001 leg Kyoto, Japan 23 Feb, 2014 KP970797 JQ650159 JQ650120 leg Kyoto, Japan 23 Feb, 2014 KP970796 leg Kyoto, Japan 17 Feb, 2005 leg Kanagawa, Japan 25 Nov, 2011 KF562882 hemolymph Kanagawa, Japan 25 Nov, 2011 KF562880 KP970708 KF563023 KF563024 leg Kanagawa, Japan 25 Nov, 2011 KF562881 hemolymph Kanagawa, Japan 25 Nov, 2011 KF562879 KF563061 hemolymph Wakayama, Japan 15 May, 2011 KF562867 wing muscle Taiwan 27 Sep, 2011 JQ650221 wing muscle Taiwan 27 Sep, 2011 KF563028 sperm vesicles Taiwan 27 Sep, 2011 JQ650220 KF562953 KF563027 Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher OPU_BS_Eh2011-516 OPU_BS_Eh2011-517 OPU_BS_Eh2011-518 OPU_BS_Ey2011-168 OPU_BS_Ey2011-625 OPU_BS_Ey2011-626 OPU_BS_Ey2011-627 OPU_BS_Ey2011-628 OPU_BS_Bf2013-360 OPU_BS_Cg2014-14 OPU_BS_Cg2014-15 OPU_BS_C2011-90 OPU_BS_C2011-91 OPU_BS_C2012-130 OPU_BS_C2012-221 Cxx2009-20-Niugawa Cxx2009-21-Niugawa Family name Species name Heptageniidae Bleptus fasciatus Cinygmula grandifolia Cinygmula grandifolia XXX2009-27Oosako-U OPU_BS_Eb2012-229 OPU_BS_Eb2012-230 OPU_BS_Et2010-212 OPU_BS_Et2010-214 OPU_BS_Et2013-148 OPU_BS_Et2013-150 OPU_BS_Ev2012-197 OPU_BS_Ev2012-198 OPU_BS_Ev2012-199 OPU_BS_Ey2011-164 Ecdyonurus tigris Ecdyonurus tigris Ecdyonurus tobiironis Ecdyonurus tobiironis DNA barcodes of Japanese mayflies Ecdyonurus sp. Table 1. Accession numbers of sequence data and source information. Stage nymph nymph imago imago imago nymph subimago subimago subimago subimago imago nymph nymph imago imago imago subimago subimago imago imago imago imago subimago subimago subimago imago imago imago imago imago sperm vesicles sperm vesicles sperm vesicles sperm vesicles sperm vesicles wing muscle sperm vesicles wing muscle sperm vesicles sperm vesicles Nara, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Nara, Japan Nara, Japan Nara, Japan Nara, Japan Nara, Japan sperm vesicles Nara, Japan sperm vesicles Kyoto, Japan wing muscle Nara, Japan 8 May, 2010 Apr, 1997 14 Apr, 2011 14 Apr, 2011 25 Apr, 2004 25 Apr, 2010 25 Apr, 2010 25 Apr, 2010 14 Apr, 2011 14 Apr, 2011 14 Apr, 2011 14 Apr, 2011 14 Apr, 2011 JQ650172 EF680333 JQ650212 JQ650213 JQ650214 JQ650174 JQ650175 JQ650176 KF562869 JQ650177 JQ650131 JQ655115 JQ650119 JQ650130 KF563019 KF563020 KF563007 KF563008 sperm vesicles Nara, Japan 27 Apr, 2013 wing muscle Nara, Japan 27 Apr, 2013 sperm vesicles Nara, Japan 27 Apr, 2013 sperm vesicles Kanagawa, Japan 12 Sep, 2011 KP970762 KP970763 KP970764 JQ650207 EF680324 AY870289 JQ650128 JQ650118 AY870290 leg Kanagawa, Japan 12 Sep, 2011 JQ650217 KF563026 KP970686 KP970687 KF563017 leg Kanagawa, Japan 12 Sep, 2011 JQ650216 wing muscle Nara, Japan 27 Apr, 2013 JQ650163 sperm vesicles Nara, Japan 27 Apr, 2013 sperm vesicles Nara, Japan 27 Apr, 2013 KP970769 wing muscle Nara, Japan 27 Apr, 2013 KP970768 wing muscle Nara, Japan 27 Apr, 2013 KP970767 whole body Wakayama, Japan 5 May, 2012 KP970810 KP970754 KP970690 KP970691 KP970692 KP970693 KP970696 wing muscle Wakayama, Japan 5 May, 2012 KF562876 wing muscle Wakayama, Japan 5 May, 2012 KF562910 wing muscle Wakayama, Japan 5 May, 2012 KF562909 hemolymph Fukuoka, Japan Apr, 2012 KF562923 hemolymph Fukuoka, Japan Apr, 2012 KF562922 Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher OPU_BS_E2012-190 OPU_BS_E2012-191 OPU_BS_E2012-131 OPU_BS_E2012-133 OPU_BS_E2012-132 OPU_BS_E2012-225 OPU_BS_E2013-71 OPU_BS_E2013-72 OPU_BS_E2013-74 OPU_BS_E2013-76 OPU_BS_E2013-130 OPU_BS_E2011-513 OPU_BS_E2011-514 OPU_BS_E2011-515 OPU_BS_Ea2013-55 OPU_BS_Ea2013-57 OPU_BS_Ea2013-58 OPU_BS_Ec2010-226 EI1997Kibune OPU_BS_Ei2011-1 OPU_BS_Ei2011-2 EL2004Niugawa38 OPU_BS_El2010-4 OPU_BS_El2010-7 OPU_BS_El2010-8 OPU_BS_El2011-20 OPU_BS_El2011-21 OPU_BS_El2011-22 OPU_BS_El2011-23 OPU_BS_El2011-24 Family name Species name Ecdyonurus sp. Ecdyonurus sp. Ecdyonurus sp. K. Wakimura, et al. Ecdyonurus sp. Ecdyonurus sp. Ecdyonurus sp. Ecdyonurus sp. Ecdyonurus sp. Ecdyonurus sp. Ecdyonurus sp. Ecdyonurus sp. Epeorus curvatulus Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Table 1. Accession numbers of sequence data and source information. Stage imago imago imago imago imago imago imago subimago subimago subimago subimago subimago imago imago imago nymph nymph nymph nymph nymph nymph imago imago imago imago imago imago imago nymph wing muscle sperm vesicles wing muscle whole body wing muscle sperm vesicles wing muscle sperm vesicles Nara, Japan Kyoto, Japan Kyoto, Japan Kyoto, Japan Kyoto, Japan Kyoto, Japan Kyoto, Japan Nara, Japan hemolymph Shiga, Japan whole body Nara, Japan whole body Nara, Japan whole body Nara, Japan whole body Nara, Japan 14 Dec, 2012 14 Dec, 2012 14 Dec, 2012 14 Dec, 2012 Mar, 2012 9 May, 2009 27 Apr, 2008 27 Apr, 2008 27 Apr, 2008 27 Apr, 2008 27 Apr, 2008 27 Apr, 2008 14 Dec, 2012 KF562894 KF562976 KF562875 GU354160 whole body Nara, Japan 14 Dec, 2012 sperm vesicles Nara, Japan 9 May, 2009 leg Wakayama, Japan 11 May, 2014 GU354159 KF562896 KF562897 KF562898 KP970812 KP970755 KP970756 GU354164 JQ319378 JQ319379 JQ319380 JQ319381 JQ319382 JQ319383 leg Wakayama, Japan 11 May, 2014 wing muscle Nara, Japan 27 Apr, 2013 sperm vesicles Nara, Japan 27 Apr, 2013 KP970761 KP970700 KP970713 KP970714 GU354163 wing muscle Nara, Japan 27 Apr, 2013 KP970760 wing muscle Nara, Japan 27 Apr, 2013 KP970759 wing muscle Nara, Japan 27 Apr, 2013 KP970758 sperm vesicles Nara, Japan 14 Apr, 2011 JQ650157 sperm vesicles Nara, Japan 14 Apr, 2011 JQ650156 KF563022 sperm vesicles Nara, Japan 14 Apr, 2011 JQ650155 sperm vesicles Nara, Japan 14 Apr, 2011 KF562872 sperm vesicles Nara, Japan 14 Apr, 2011 JQ650178 JQ650132 wing muscle Nara, Japan 14 Apr, 2011 KF562871 JQ650154 wing muscle Nara, Japan 14 Apr, 2011 KF562870 Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher OPU_BS_El2011-25 OPU_BS_El2011-26 OPU_BS_El2011-27 OPU_BS_El2011-28 OPU_BS_El2011-29 OPU_BS_El2011-30 OPU_BS_El2011-56 OPU_BS_El2013-1 OPU_BS_El2013-2 OPU_BS_El2013-4 OPU_BS_El2013-5 OPU_BS_El2013-143 OPU_BS_El2014-1 OPU_BS_El2014-2 Family name Species name Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Ena2009-125Sannokou OPU_BS_En2012-251 OPU_BS_En2012-252 OPU_BS_En2012-253 OPU_BS_E2012-235 OPU_BS_E2012-236 OPU_BS_Hk2012-24 Epeorus sp. Epeorus sp. Heptagenia kihada Proepeorus nipponicus Rhithrogena japonica Eni2009-131Nakaigawa KU_Rj2008-63 KU_Rj2008-64 KU_Rj2008-65 KU_Rj2008-67 KU_Rj2008-68 KU_Rj2008-69 OPU_BS_Rj2012-241 Rhithrogena japonica Rhithrogena japonica DNA barcodes of Japanese mayflies Rhithrogena japonica Rhithrogena japonica Rhithrogena japonica Rhithrogena japonica Table 1. Accession numbers of sequence data and source information. Stage nymph imago imago imago imago imago imago imago nymph nymph nymph imago imago subimago nymph nymph imago subimago subimago subimago subimago subimago imago imago imago imago imago imago imago sperm vesicles sperm vesicles wing muscle sperm vesicles sperm vesicles sperm vesicles wing muscle wing muscle wing muscle wing muscle Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan wing muscle Wakayama, Japan sperm vesicles Wakayama, Japan sperm vesicles Nara, Japan 25 Apr, 2009 24 Apr, 2010 24 Apr, 2010 24 Apr, 2010 24 Apr, 2010 24 Apr, 2010 5 May, 2012 5 May, 2012 5 May, 2012 5 May, 2012 5 May, 2012 5 May, 2012 5 May, 2012 KF562877 KF562914 KF562911 KF562912 KF562913 KF562962 KF562964 KF562965 KF562966 KF562967 KF562968 KF562969 JQ650203 JQ650146 leg Saitama, Japan 6 Dec, 2008 leg Saitama, Japan 6 Dec, 2008 wing muscle Kanagawa, Japan 16 Nov, 2011 wing muscle Kanagawa, Japan 16 Nov, 2011 JQ650198 KP970786 KP970787 GU354153 JQ650202 KF563012 KF563013 KF563010 KF563014 GQ433997 sperm vesicles Kanagawa, Japan 16 Nov, 2011 whole body Okinawa, Japan 23 Apr, 2012 KF562936 JQ650139 JQ650140 JQ650141 KP970706 KP970707 whole body Okinawa, Japan 22 Apr, 2012 KF562935 hemolymph Okinawa, Japan 22 Apr, 2012 KF562934 sperm vesicles Nara, Japan 25 Apr, 2009 GU354149 KF563058 sperm vesicles Nara, Japan 25 Apr, 2009 GU354148 sperm vesicles Nara, Japan 25 Apr, 2009 GU354147 sperm vesicles Wakayama, Japan 25 Apr, 2004 EF680332 AY850372 sperm vesicles Wakayama, Japan 24 Apr, 2005 JQ319386 sperm vesicles Wakayama, Japan 24 Apr, 2005 JQ319385 sperm vesicles Wakayama, Japan 24 Apr, 2005 JQ319384 whole body Nara, Japan 14 Dec, 2012 KF562895 KF562977 OPU_Rj2005-02 OPU_Rj2005-07 OPU_Rj2005-10 RJ2004Niugawa1 Rja2009-01-Oosako-U Rja2009-02-Oosako-U Rja2009-03-Oosako-U OPU_BS_Rm2012-216 OPU_BS_Rm2012-217 OPU_BS_Rm2012-218 OPU_BS_Rt2011-601 OPU_BS_Rt2011-602 OPU_BS_Rt2011-603 OPU_BS_Rt2013-358 OPU_BS_Rt2013-359 Rxx2009-08-Oosako-U OPU_BS_R2010-11 OPU_BS_R2010-15 OPU_BS_R2010-16 OPU_BS_R2010-12 OPU_BS_R2010-19 OPU_BS_R2012-102 OPU_BS_R2012-153 OPU_BS_R2012-154 OPU_BS_R2012-155 OPU_BS_R2012-156 OPU_BS_R2012-157 OPU_BS_R2012-158 Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher OPU_BS_Rj2012-242 Family name Species name Rhithrogena japonica Rhithrogena japonica Rhithrogena japonica K. Wakimura, et al. Rhithrogena japonica Rhithrogena japonica Rhithrogena japonica Rhithrogena japonica Rhithrogena japonica Rhithrogena tetrapunctigera Rhithrogena tetrapunctigera Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Table 1. Accession numbers of sequence data and source information. Stage imago subimago subimago subimago imago nymph nymph nymph imago imago nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph hemolymph whole body hemolymph whole body hemolymph wing muscle whole body wing muscle wing muscle wing muscle Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Kanagawa, Japan Kanagawa, Japan Nara, Japan Wakayama, Japan wing muscle Fukuoka, Japan hemolymph Fukuoka, Japan hemolymph Fukuoka, Japan hemolymph Fukuoka, Japan 16 Apr, 2012 16 Apr, 2012 16 Apr, 2012 16 Apr, 2012 5 May, 2012 5 May, 2012 5 May, 2012 15 May, 2011 5 May, 2012 15 May, 2011 Mar, 2012 Mar, 2012 14 May, 2011 15 May, 2011 KP970807 KP970808 KP970809 KF562866 KF562937 KF562868 KF562902 KF562903 JQ650193 KP970806 KF562989 KF562990 KP970750 KF563040 KF563041 KP970751 KP970752 KP970753 JQ650124 KF563000 hemolymph Fukuoka, Japan 16 Apr, 2012 hemolymph Kanagawa, Japan Mar, 2012 hemolymph Kanagawa, Japan Mar, 2012 hemolymph Kanagawa, Japan Mar, 2012 hemolymph Kanagawa, Japan Mar, 2012 KF562886 hemolymph Kanagawa, Japan Mar, 2012 KF562885 wing muscle Nara, Japan 15 Apr, 2011 wing muscle Nara, Japan 15 Apr, 2011 JQ650189 JQ650161 KF563005 KF562974 hemolymph Nara, Japan 14 May, 2011 JQ650195 JQ650127 KF563033 KF563034 KF563035 KF563036 KF563037 KF563042 KF563043 KF563044 KF563045 KF563046 hemolymph Nara, Japan 14 May, 2011 JQ650194 JQ650126 hemolymph Wakayama, Japan 15 May, 2011 JQ650218 wing muscle Nara, Japan 8 May, 2010 JQ650210 sperm vesicles Nara, Japan 15 Apr, 2011 JQ650191 JQ650123 sperm vesicles Nara, Japan 15 Apr, 2011 JQ650186 JQ650121 wing muscle Nara, Japan 15 Apr, 2011 JQ650185 JQ650136 OPU_BS_Ce2011-98 OPU_BS_Ce2011-99 OPU_BS_Ce2011-128 OPU_BS_Cn2010-363 OPU_BS_ Cn2011-171 OPU_BS_Cn2011-308 OPU_BS_Co2011-309 OPU_BS_C2011-113 OPU_BS_C2011-117 OPU_BS_Db2012-1 OPU_BS_Db2012-2 OPU_BS_Db2012-5 OPU_BS_Db2012-6 OPU_BS_Db2012-7 OPU_BS_Db2012-100 OPU_BS_Db2012-101 OPU_BS_Db2012-160 OPU_BS_Db2012-161 OPU_BS_Db2012-164 OPU_BS_D2012-222 OPU_BS_D2012-223 OPU_BS_D2012-224 OPU_BS_Di2011-165 OPU_BS_Dk2012-220 OPU_BS_Di2011-170 OPU_BS_Ds2012-54 OPU_BS_Ds2012-55 OPU_BS_Dt2011-255 OPU_BS_D2011-166 wing muscle Wakayama, Japan 28 Apr, 2013 KP970781 OPU_BS_H2013-235 Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher Family name Species name Heptageniidae sp. Ephemerellidae Cincticostella orientalis Cincticostella sp. Cincticostella sp. Drunella basalis Drunella basalis Drunella basalis Drunella basalis Drunella basalis Drunella basalis Drunella basalis Drunella basalis Drunella basalis Drunella basalis Drunella ishiyamana Drunella kohnoi DNA barcodes of Japanese mayflies Drunella trispina Table 1. Accession numbers of sequence data and source information. Stage nymph nymph nymph nymph nymph nymph nymph hemolymph hemolymph whole body hemolymph hemolymph whole body leg leg leg leg sperm vesicles hemolymph hemolymph hemolymph wing muscle sperm vesicles abdomen abdomen abdomen abdomen abdomen abdomen whole body Nara, Japan Osaka, Japan Osaka, Japan Osaka, Japan Osaka, Japan Osaka, Japan Osaka, Japan Nara, Japan Kyushu, Japan Wakayama, Japan Kyushu, Japan Kyushu, Japan Nara, Japan 25 Apr, 2009 Mar, 2012 Mar, 2012 Mar, 2012 5 May, 2012 27 Apr, 2013 29 Jun, 2014 29 Jun, 2014 29 Jun, 2014 29 Jun, 2014 29 Jun, 2014 29 Jun, 2014 15 May, 2011 KP970802 KP970803 KP970804 JQ650125 KP970728 KP970800 KP970801 KF562905 Kyoto, Japan 13 Apr, 2014 Kyoto, Japan 13 Apr, 2014 GU354155 KF562904 KF562991 KF562959 KF562992 KF562963 KP970729 KP970725 KP970726 KP970727 KF563051 KF563053 KF563054 Kyoto, Japan 11 Apr, 2014 Kyoto, Japan 11 Apr, 2014 KP970798 KP970799 KP970723 KP970724 Kanagawa, Japan Mar, 2012 Kanagawa, Japan Mar, 2012 KF562893 Kanagawa, Japan Mar, 2012 KF562892 Shiga, Japan Mar, 2012 KF562889 KF562984 KF562986 KF562987 KF562988 KP970722 Shiga, Japan Mar, 2012 KF562888 KF562983 Shiga, Japan Mar, 2012 KF562887 KF562982 KF563038 KF563039 KF563052 nymph nymph nymph nymph nymph nymph nymph nymph nymph imago nymph nymph nymph imago imago nymph nymph nymph nymph nymph nymph nymph hemolymph Fukuoka, Japan 15 Apr, 2012 KF562921 hemolymph Fukuoka, Japan 15 Apr, 2012 KF562920 KF563050 hemolymph Fukuoka, Japan 15 Apr, 2012 KF562919 KF563049 hemolymph Fukuoka, Japan 15 Apr, 2012 KF562918 KF563048 hemolymph Fukuoka, Japan 15 Apr, 2012 KF562917 hemolymph Kanagawa, Japan Mar, 2012 KF562907 KF562961 wing muscle Kanagawa, Japan Mar, 2012 KF562906 KF562960 KF563055 Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher OPU_BS_D2012-96 OPU_BS_D2012-97 OPU_BS_D2012-178 OPU_BS_D2012-179 OPU_BS_D2012-180 OPU_BS_D2012-181 OPU_BS_D2012-182 OPU_BS_El2012-18 OPU_BS_Ea2012-33 OPU_BS_Ea2012-34 OPU_BS_Ea2012-43 OPU_BS_Ea2012-44 OPU_BS_Ea2012-45 OPU_BS_En2014-17 OPU_BS_En2014-18 OPU_BS_En2014-22 OPU_BS_En2014-23 Exx2009-16-Ootaki-D OPU_BS_E2012-86 OPU_BS_E2012-90 OPU_BS_E2012-91 OPU_BS_E2012-129 OPU_BS_E2013-51 OPU_BS_E2014-68 OPU_BS_E2014-69 OPU_BS_E2014-71 OPU_BS_E2014-72 OPU_BS_E2014-73 OPU_BS_E2014-76 OPU_BS_Ss2011-167 Family name Species name K. Wakimura, et al. Ephacerella longicaudata nymph Ephemerella sp. Ephemerella sp. Ephemerella sp. Ephemerella sp. Ephemerella sp. Ephemerella sp. Ephemerella sp. Ephemerella sp. Ephemerella sp. Ephemerella sp. Ephemerella sp. Ephemerella sp. Serratella setigera Table 1. Accession numbers of sequence data and source information. Stage nymph nymph nymph nymph nymph nymph nymph nymph subimago subimago subimago subimago nymph nymph nymph subimago nymph subimago subimago subimago subimago subimago subimago nymph nymph nymph imago imago wing muscle whole body sperm vesicles whole body whole body wing muscle sperm vesicles wing muscle Wakayama, Japan Wakayama, Japan Wakayama, Japan Kanagawa, Japan Kanagawa, Japan Nara, Japan Nara, Japan Wakayama, Japan sperm vesicles Wakayama, Japan wing muscle Nara, Japan wing muscle Nara, Japan whole body Kanagawa, Japan 9 Nov, 2011 27 Apr, 2013 27 Apr, 2013 24 Apr, 2010 24 Apr, 2010 24 Apr, 2010 24 Apr, 2010 9 Nov, 2011 16 Nov, 2011 14 Dec, 2012 25 Apr, 2009 24 Apr, 2010 JQ650200 KF562900 GU354152 JQ655111 JQ650211 JQ650149 JQ650150 JQ650151 KF562972 KF562973 KF563016 KF563030 KF563031 thorax Nara, Japan 27 Apr, 2013 whole body Nara, Japan 14 Dec, 2012 KF562874 KP970697 KP970698 KF563015 abdomen Kyoto, Japan 20 Sep, 2010 thorax Kyoto, Japan 20 Sep, 2010 KP970788 KP970789 KF562899 KP970739 KF562980 leg Wakayama, Japan 11 May, 2014 wing muscle Nara, Japan 27 Apr, 2013 KP970779 KP970715 KP970709 KP970710 KP970701 wing muscle Nara, Japan 27 Apr, 2013 KP970778 wing muscle Nara, Japan 27 Apr, 2013 KP970777 sperm vesicles Nara, Japan 25 Apr, 2009 GU354154 GQ433998 leg Okayama, Japan 16 Sep, 2012 KP970785 leg Okayama, Japan 16 Sep, 2012 KP970784 KP970738 KP970704 KP970705 hemolymph Okinawa, Japan 22 Apr, 2012 KF562926 KF562995 hemolymph Okinawa, Japan 22 Apr, 2012 KF562925 whole body Taiwan Sep, 2011 KF562957 whole body Taiwan Sep, 2011 KF562873 KF562956 JQ655119 whole body Wakayama, Japan 16 Nov, 2011 JQ650199 JQ650142 JQ655113 Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher OPU_BS_Es2011-605 OPU_BS_Tb2011-542 OPU_BS_Tb2011-543 OPU_BS_Tj2012-193 OPU_BS_Tj2012-194 OPU_BS_Uc2013-356 OPU_BS_Uc2013-357 Uru2009-10-Oosako-D OPU_BS_E2013-167 OPU_BS_E2013-168 OPU_BS_E2013-169 OPU_BS_E2014-4 OPU_BS_Ag2013-361 OPU_BS_Ag2013-362 OPU_BS_As2012-254 OPU_BS_As2013-145 OPU_BS_Ay2011-566 OPU_BS_Ay2013-131 OPU_BS_Ay2013-132 OPU_BS_Bj2010-38 OPU_BS_Bj2010-39 OPU_BS_Bj2010-40 OPU_BS_Bj2010-41 OPU_BS_Bt2011-564 OPU_BS_Bt2011-606 OPU_BS_Bt2012-261 Bxx2009-07-Oosako-U OPU_BS_B2010-23 9 Family name Species name Serratella setigera Teloganopsis brocha Teloganopsis brocha Torleya japonica Torleya japonica Uracanthella chinoi Uracanthella chinoi Uracanthella punctisetae Baetidae Acentrella gnom Acentrella gnom Acentrella sibirica Acentrella sibirica DNA barcodes of Japanese mayflies Baetis sp. Baetis sp. Table 1. Accession numbers of sequence data and source information. Stage imago imago imago imago imago imago subimago subimago imago subimago subimago imago nymph nymph nymph nymph nymph nymph nymph nymph nymph imago imago imago imago nymph nymph nymph sperm vesicles whole body whole body whole body wing muscle Taiwan Taiwan Miyagi, Japan Miyagi, Japan Miyagi, Japan leg leg thorax Kyoto, Japan Wakayama, Japan Wakayama, Japan thorax Kyoto, Japan whole body Kanagawa, Japan whole body Kanagawa, Japan whole body Wakayama, Japan 5 May, 2012 25 Nov, 2011 25 Nov, 2011 20 Sep, 2010 20 Sep, 2010 11 May, 2014 11 May, 2014 Sep, 2011 Sep, 2011 8 Aug, 2010 8 Aug, 2010 8 Aug, 2010 JQ650223 JQ650224 JQ650164 JQ650167 JQ650168 JQ650169 JQ655117 whole body Wakayama, Japan 5 May, 2012 thorax Chiba, Japan 9 May, 2009 thorax Chiba, Japan 9 May, 2009 KP970782 KF562940 KF562939 KF562884 KF562883 KP970790 KP970791 KP970740 KP970741 KP970711 KP970712 KP970716 KP970717 whole body Kanagawa, Japan 24Nov, 2011 KF562878 KP970734 KP970735 KF562975 KF563002 thorax Nara, Japan 27 Apr, 2013 KP970776 wing muscle Nara, Japan 27 Apr, 2013 sperm vesicles Nara, Japan 27 Apr, 2013 KP970771 KP970699 KF563032 KF563060 KF563059 wing muscle Nara, Japan 27 Apr, 2013 KP970770 wing muscle Nara, Japan 27 Apr, 2013 thorax Nara, Japan 27 Apr, 2013 whole body Nara, Japan 14 May, 2011 KF562950 wing muscle Nara, Japan 15 Apr, 2011 JQ650192 JQ650138 JQ655116 KP970694 KP970695 sperm vesicles Nara, Japan 14 Apr, 2011 JQ650182 JQ650158 wing muscle Nara, Japan 14 Apr, 2011 JQ650173 JQ650129 wing muscle Wakayama, Japan 24 Apr, 2010 JQ650208 wing muscle Wakayama, Japan 24 Apr, 2010 JQ655112 Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher Family name Species name Baetis sp. Baetis sp. OPU_BS_B2010-23 clone 2 OPU_BS_B2010-24 OPU_BS_B2011-19 OPU_BS_B2011-74 OPU_BS_B2011-147 OPU_BS_B2011-494 OPU_BS_B2013-85 OPU_BS_B2013-101 OPU_BS_B2013-102 OPU_BS_B2013-103 OPU_BS_B2013-134 OPU_BS_B2013-166 OPU_BS_La2011-614 OPU_BS_Lt2013-352 OPU_BS_Lt2013-353 OPU_BS_Nc2012-227 OPU_BS_N2012-226 OPU_BS_Bt2011-607 OPU_BS_Bt2011-608 OPU_BS_Tf2013-363 OPU_BS_Tf2013-364 OPU_BS_B2014-5 OPU_BS_B2014-6 OPU_BS_Ef2011-525 OPU_BS_Ef2011-526 OPU_BS_Ej2010-EJ1 OPU_BS_Ej2010-EJ2 OPU_BS_Ej2010-EJ3 Baetis sp. K. Wakimura, et al. Baetis sp. Baetis sp. Baetis sp. Baetis sp. Baetis sp. Baetis sp. Baetis sp. Baetis sp. Baetis sp. Labiobaetis atrebatinus orientalis Labiobaetis tricolor Labiobaetis tricolor Nigrobaetis chocoratus Nigrobaetis sp. D Nigrobaetis taiwanensis Nigrobaetis taiwanensis Tenuibaetis flexifemora Tenuibaetis flexifemora Baetidae sp. Baetidae sp. Ephemeridae Ephemera formosana Ephemera formosana Ephemera japonica Ephemera japonica Ephemera japonica Table 1. Accession numbers of sequence data and source information. Stage nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph imago imago imago imago nymph nymph nymph nymph sperm vesicles sperm vesicles sperm vesicles wing muscle sperm vesicles sperm vesicles sperm vesicles sperm vesicles whole body whole body whole body Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Nara, Japan Nara, Japan Kanagawa, Japan Kanagawa, Japan Kanagawa, Japan Nara, Japan Nara, Japan whole body Taiwan Sep, 2011 25 Apr, 2009 25 Apr, 2009 24 Apr, 2010 24 Apr, 2010 9 Apr, 2006 9 Apr, 2006 14 Apr, 2011 14 Apr, 2011 12 Sep, 2011 12 Sep, 2011 12 Sep, 2011 JQ650219 JQ650180 JQ650181 JQ650204 JQ650205 GU354146 whole body Taiwan Sep, 2011 whole body Miyagi, Japan 8 Aug, 2010 JQ650225 whole body Miyagi, Japan 8 Aug, 2010 sperm vesicles Nara, Japan 25 Apr, 2009 GU354151 JQ650170 JQ650171 JQ650165 JQ650166 GQ433999 GQ434000 JQ650144 JQ650145 EF055451 JQ650134 JQ650135 KF562951 KF562952 KF563011 GU354161 JQ655114 JQ655118 sperm vesicles Kyoto, Japan sperm vesicles Kyoto, Japan EF680329 AY860841 sperm vesicles Kyoto, Japan EF680328 wing muscle Shiga, Japan Mar, 2012 KF562891 KF562958 wing muscle Shiga, Japan Mar, 2012 KF562890 KF562985 wing muscle Fukushima, Japan 11 Sep, 2011 KF562948 wing muscle Fukushima, Japan 11 Sep, 2011 KF562947 wing muscle Fukushima, Japan 11 Sep, 2011 KF562946 wing muscle Fukushima, Japan 11 Sep, 2011 KF562945 wing muscle Fukushima, Japan 11 Sep, 2011 KF562944 wing muscle Fukushima, Japan 11 Sep, 2011 KF562943 hemolymph Kanagawa, Japan 12 Sep, 2011 JQ650197 whole body Kanagawa, Japan 12 Sep, 2011 JQ650153 Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher OPU_BS_Ej2011-507 OPU_BS_Ej2011-508 OPU_BS_Ej2012-265 OPU_BS_Ej2012-266 OPU_BS_Ej2012-267 OPU_BS_Ej2012-268 OPU_BS_Ej2012-269 OPU_BS_Ej2012-270 OPU_BS_Eo2012-35 OPU_BS_Eo2012-36 ES2002Kyoto1 ES2002Kyoto2 ES2002Kyoto Est2009-06-Oosako-U OPU_BS_Es2010-ES2 OPU_BS_Es2010-ES3 OPU_BS_Cn2011-534 OPU_BS_Cn2011-539 Pch2009-17-Ootaki-D Pch2009-18-Ootaki-D OPU_BS_Pj2010-13 OPU_BS_Pj2010-14 PS2006Niugawa-1 PS2006Niugawa 1-2-3 OPU_BS_Ps2011-41 OPU_BS_Ps2011-42 OPU_BS_Pw2011-495 OPU_BS_Pw2011-496 OPU_BS_Pw2011-502 Family name Species name Ephemera japonica Ephemera japonica Ephemera japonica Ephemera japonica Ephemera japonica Ephemera japonica Ephemera japonica Ephemera japonica Ephemera orientalis Ephemera orientalis Leptophlebiidae Choroterpides nigella Choroterpides nigella Paraleptophlebia chocolataimago Paraleptophlebia chocolataimago Paraleptophlebia japonica subimago Paraleptophlebia japonica subimago DNA barcodes of Japanese mayflies Table 1. Accession numbers of sequence data and source information. Stage wing muscle wing muscle whole body whole body wing muscle wing muscle sperm vesicles sperm vesicles hemolymph hemolymph hemolymph whole body sperm vesicles wing muscle wing muscle sperm vesicles ovary wing muscle wing muscle sperm vesicles wing muscle wing muscle wing muscle whole body leg hemolymph leg Nara, Japan Wakayama, Japan Wakayama, Japan Nara, Japan Nara, Japan Nara, Japan Kyoto, Japan Fukuoka, Japan Kyoto, Japan Nara, Japan Nara, Japan Nara, Japan 25 Apr, 2009 25 Apr, 2009 27 Apr, 2013 27 Apr, 2013 24 Apr, 2010 24 Apr, 2010 15 Apr, 2011 15 Apr, 2010 14 Dec, 2012 11 Apr, 2014 15 Apr, 2012 11 Apr, 2014 Nara, Japan 15 Apr, 2011 Nara, Japan 14 Apr, 2011 Kyoto, Japan Apr, 1997 EF680323 JQ650179 JQ650188 GU354150 KP970765 KP970766 JQ650215 JQ650201 JQ650187 JQ650190 KF562901 KF562924 KP970795 Okinawa, Japan 23 Apr, 2012 KF562933 Okinawa, Japan 23 Apr, 2012 KF562932 Okinawa, Japan 23 Apr, 2012 KF562931 Okinawa, Japan 23 Apr, 2012 KF562930 KF562996 KF562997 KF562998 KF562999 AY870291 JQ650133 JQ650160 GQ433995 GQ433996 KP970730 JQ650152 JQ650143 JQ650137 JQ650122 KF562981 KP970747 KF562994 KP970748 KF563056 KF563009 KP970688 KP970689 KF563021 KF563057 Wakayama, Japan 28 Apr, 2013 KP970780 KP970733 Wakayama, Japan 28 Apr, 2013 KP970732 Nara, Japan 27 Apr, 2013 KP970773 KP970731 Nara, Japan 27 Apr, 2013 KP970772 Nara, Japan 14 Dec, 2012 KF562979 Nara, Japan 14 Dec, 2012 KF562978 Nara, Japan 8 May, 2010 JQ650209 JQ650148 KF563018 Kanagawa, Japan 12 Sep, 2011 JQ650196 KF563025 subimago nymph nymph imago subimago imago subimago nymph nymph nymph nymph imago imago imago imago imago subimago subimago imago imago imago subimago nymph nymph nymph nymph Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher OPU_BS_Pw2011-504 OPU_BS_P2010-362 OPU_BS_P2012-248 OPU_BS_P2012-249 OPU_BS_P2013-105 OPU_BS_P2013-106 OPU_BS_P2013-200 OPU_BS_P2013-202 OPU_BS_Tg2012-210 OPU_BS_Tg2012-211 OPU_BS_Tg2012-212 OPU_BS_Tg2012-214 AC1997Kibune-O OPU_BS_Ac2011-38 OPU_BS_Ac2011-108 Family name Species name Paraleptophlebia westoni imago K. Wakimura, et al. Ameletidae Amo2009-04Oosako-U Amo2009-05Oosako-U OPU_BS_Am2013-67 OPU_BS_Am2013-68 OPU_BS_A2010-9 OPU_BS_A2010-10 OPU_BS_A2011-106 OPU_BS_A2011-122 OPU_BS_A2012-262 OPU_BS_A2014-12 OPU_BS_Pf2012-192 OPU_BS_Pf2014-13 Potamanthidae Table 1. Accession numbers of sequence data and source information. Stage imago imago imago nymph nymph nymph nymph nymph nymph nymph nymph imago nymph nymph nymph thorax Okayama, Japan thorax Okayama, Japan 16 Sep, 2011 16 Sep, 2011 KP970783 wing muscle Wakayama, Japan 15 May, 2011 whole body Nara, Japan 14 May, 2011 KP970805 KF562949 leg Kyoto, Japan 11 Apr, 2014 KP970757 KF563006 KP970736 KP970737 leg Kyoto, Japan 11 Apr, 2014 leg Kyoto, Japan 11 Apr, 2014 KP970794 KP970744 KP970745 KP970746 leg Kyoto, Japan 11 Apr, 2014 KP970793 KP970743 leg Kyoto, Japan 11 Apr, 2014 KP970792 KP970742 hemolymph Fukuoka, Japan 16 Apr, 2012 KF562971 hemolymph Fukuoka, Japan 16 Apr, 2012 KF562916 KF562993 KF563047 KP970718 KP970719 KP970720 KP970721 KP970702 KP970703 wing muscle Fukuoka, Japan 16 Apr, 2012 KF562915 KF562970 wing muscle Taiwan Sep, 2011 KF562955 KF563029 sperm vesicles Taiwan Sep, 2011 JQ650222 KF562954 leg Nara, Japan 6 Jul, 2014 KP970749 OPU_BS_Pf2014-77 OPU_BS_Pi2011-521 OPU_BS_Pi2011-522 OPU_BS_Ss2012-174 OPU_BS_Ss2012-175 OPU_BS_Ss2012-176 OPU_BS_S2014-7 OPU_BS_S2014-8 OPU_BS_S2014-9 OPU_BS_S2014-10 OPU_BS_S2014-11 OPU_BS_C2011-493 OPU_BS_Ij2011-169 OPU_BS_Es2013-354 OPU_BS_Es2013-355 DNA barcodes of Japanese mayflies Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher Family name Species name Potamanthus idiocerus Potamanthus idiocerus Siphlonuridae Caenidae Caenis sp. Isonychiidae Isonychia japonica Polymitarcyidae Ephoron shigae Ephoron shigae K. Wakimura, et al. Table 2. DNA primers used for PCR and sequencing analysis. Primer name HexAF HexAR LCO1490 HCO2198 KOBO18SF1 KOBO18SR1 Sequence atggctcgtaccaagcagacggc atatccttgggcatgatggtgac ggtcaacaaatcataaagatattgg taaacttcagggtgaccaaaaaatca tggcgtatattaaagttgttgcggt agtttcagctttgcaaccatacttc V4 and V5 region of 18S rRNA 55°C Kobori et al., unpublished. cytochrome oxidase subunit 1 45°C Folmer et al. [19] Target histone H3 Annealing temperature 55°C Reference Ogden & Whiting [18] 3 Results and discussion A total of 486 sequences data (118 of COI, 214 of 18S rRNA, and 154 of histone H3) have been deposited in GenBank/ EMBL/ DDBJ International Nucleotide Databases, from which they can be retrieved using the search terms "Ephemeroptera" + "Osaka Prefecture" + gene name. Accession numbers of sequence data are listed on Table 1. Lack of an accession number means the sequence was not determined. Some of them were difficult to amplify by PCR under the conditions indicated, and some were postponed because of lower priority of analysis (large effort was made to analyze the unsequenced species). A portion of the DNA sequences (98 among 486 sequences) were not registered with full scientific names due to our conservative way of identification, thus were not applicable to DNA barcoding at the species level. However, their registration with precise information on sampling locations and time (year/ month) is still beneficial for ecological and conservation studies. Comparing with sequence data from undoubtedly identified specimens, which was already registered in the database or will be registered in the course of future studies, the sequences from our ambiguous specimens may be used in the estimation of habitat range and its temporal change. In the phylogenetic trees of COI and H3, the family Heptageniidae was divided into three distant clusters or singletons (Figs. 1A and 1B). This could be the result of long branch attraction [14] due to the highly variable nature of these genes, or saturation of substitutions at the third positions of codons [15]. The low levels of support for the estimated phylogenetic relationships at higher taxonomic levels (i.e., family and genus), however, does not lessen the validity of species-level identification [16,17]. The 18S rRNA tree showed monophyletic clustering of families (Fig. 1C) when the highly variable V4 stem-loop regions (containing many insertions/deletions that were impossible to align unambiguously) were excluded from the analysis. The specimen of Nigrobaetis sp. D (N2012-226) was recovered in its expected position as sister-group to Nigrobaetis chocoratus (Nc2012-227) in both the COI and 18S trees (Fig. 1A and Fig. 1C) but in the histone H3 tree (Fig. 1B) it is placed well within a clade comprising Empherellidae specimens, as sister-group to Ephemeralla sp. (E2012-86). It is possible that we amplified a paralogous copy of the histone H3 gene in this instance, or that there might have been cross-contamination of samples, however as we do not have any further specimens of Nigrobaetis sp. D we cannot test this hypothesis. Our results suggest that because of their higher evolutionary rates, COI and H3 are not suitable in inferring phylogenetic relationship among families but were useful in identifying species (i.e., DNA barcoding). In contrast, the more conserved 18S rRNA gene was useful in confirming the integrity of the source DNA samples (e.g. contamination) and was adequately informative for elucidating inter-family divergence, but not suitable for species identification. We also found intraspecific variations in COI sequences of some species (Fig. 2), that can be applicable to characterizing the genetic structures of populations. The maximum intraspecific variation seen in and Drunella basalis was 4.9% and 3.3%, respectively. This may suggest that cryptic species exist within these species. In conclusion, we collected DNA samples of 80 taxa of Ephemeroptera, covering ca. 60% of mayfly species in Japan. We analyzed COI, histone H3, and 18S rRNA sequences with 39, 46, and 61 species, respectively, which were morphologically identified. Our results indicated that COI, histone H3 gene sequences could serve as markers for species identification, whereas more conserved 18S rRNA gene could serve a marker for quality control of DNA samples. Sequence data presented in this study would also contribute to the population genetics studies by comparing the haplotype frequency of certain species in the future. DNA barcodes of Japanese mayflies Figure 1A. Phylogenetic trees of three genes reconstructed with nucleotide sequences. A, COI tree; B, histone H3 tree; C, 18S rRNA tree. Phylogenetic trees were reconstructed by the neighbor-joining method with sequence data of three genes (COI, H3, and 18S rRNA). The trees were rooted using outgroup sequences from Odonata. Species names were followed by the specimen IDs. Bootstrap reproducibility scores (50 %) were indicated at respective nodes. Specimen IDs marked with asterisk (*) indicates that a whole body was used for DNA extraction (i.e., unable to re-examine species morphologically). The V4 stem-loop region of 18S rRNA (corresponding to the position 650-788 of X89481, Misof et al. [5]) was trimmed from the sequence data in this phylogenetic analysis. K. Wakimura, et al. Figure 1B. Phylogenetic trees of three genes reconstructed with nucleotide sequences. A, COI tree; B, histone H3 tree; C, 18S rRNA tree. Phylogenetic trees were reconstructed by the neighbor-joining method with sequence data of three genes (COI, H3, and 18S rRNA). The trees were rooted using outgroup sequences from Odonata. Species names were followed by the specimen IDs. Bootstrap reproducibility scores (50 %) were indicated at respective nodes. Specimen IDs marked with asterisk (*) indicates that a whole body was used for DNA extraction (i.e., unable to re-examine species morphologically). The V4 stem-loop region of 18S rRNA (corresponding to the position 650-788 of X89481, Misof et al. [5]) was trimmed from the sequence data in this phylogenetic analysis. DNA barcodes of Japanese mayflies Figure 1C. Phylogenetic trees of three genes reconstructed with nucleotide sequences. A, COI tree; B, histone H3 tree; C, 18S rRNA tree. Phylogenetic trees were reconstructed by the neighbor-joining method with sequence data of three genes (COI, H3, and 18S rRNA). The trees were rooted using outgroup sequences from Odonata. Species names were followed by the specimen IDs. Bootstrap reproducibility scores (50 %) were indicated at respective nodes. Specimen IDs marked with asterisk (*) indicates that a whole body was used for DNA extraction (i.e., unable to re-examine species morphologically). The V4 stem-loop region of 18S rRNA (corresponding to the position 650-788 of X89481, Misof et al. [5]) was trimmed from the sequence data in this phylogenetic analysis. K. Wakimura, et al. Acknowledgements: The authors would like to thank Ms. Tamami Adachi for her help in DNA sequencing, Dr. Toshihito Fujitani for identification of some specimens belonging to Baetidae, and Tamagawakyo-wo-Mamorukai (Hashimoto City, Wakayama, Japan), a citizens' group working for nature studies and conservation, for their help and support in collecting mayfly samples in KiiNyugawa River. This work was partially supported by Water Resources Environment Technology Center (Grant Number 2008-04) and Ministry of Education, Culture, Sports, Science and Technology of Japan (MEXT KAKENHI Grant Number 25289172). DNA barcodes of Japanese mayflies K. Wakimura, et al. DNA barcodes of Japanese mayflies K. Wakimura, et al. DNA barcodes of Japanese mayflies K. Wakimura, et al. DNA barcodes of Japanese mayflies Conflict of interest: Authors declare nothing to disclose. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png DNA Barcodes de Gruyter

Characterization of genes for histone H3, 18S rRNA, and cytochrome oxidase subunit I of East Asian mayflies (Ephemeroptera)

Download PDF
25 pages

Loading next page...
 
/lp/de-gruyter/characterization-of-genes-for-histone-h3-18s-rrna-and-cytochrome-6VBCxBaBJJ
Publisher
de Gruyter
Copyright
Copyright © 2016 by the
eISSN
2299-1077
DOI
10.1515/dna-2016-0001
Publisher site
See Article on Publisher Site

Abstract

We have determined nucleotide sequences of three genes encoding histone H3, 18S rRNA, and mitochondrial cytochrome oxidase subunit I (COI) from the mayfly community in Eastern Asia. All sequence data collected from 303 specimens comprising 80 taxa (63 identified to species, 14 to genus, and 3 to family) were deposited in GenBank/ EMBL/ DDBJ International Databases for further expansion of DNA barcoding projects of mayflies. Phylogenetic analysis based on the neighborjoining method among the three genes found that COI and H3 genes had relatively high evolutionary rates, and were not suitable in inferring phylogenetic relationships among Article note: N. Shimizu, who designed the work and was responsible for DNA sequencing, passed away on June 5, 2015, after his approval for submitting the manuscript on May 26, 2015. This paper is dedicated to him. *Corresponding author Mikio Kato, Biology Laboratory, Faculty of Liberal Arts and Sciences, Osaka Prefecture University, 1-1 Gakuencho, Naka-ku, Sakai 599-8531, Japan, E-mail: mkato@b.s.osakafu-u.ac.jp Kei Wakimura, Biology Laboratory, Faculty of Liberal Arts and Sciences, Osaka Prefecture University, 1-1 Gakuencho, Naka-ku, Sakai 599-8531, Japan Yasuhiro Takemon, Disaster Prevention Research Institute, Kyoto University, Uji 611-0011, Japan Atsushi Takayanagi, Nobuyoshi Shimizu, Advanced Research Center for Genome Super Power, Keio University, 2 Ohkubo, Tsukuba 3002611, Japan Shin-ichi Ishiwata, Department of Applied Chemistry, Kanagawa Institute of Technology, 1030 Shimo-Ogino, Atsugi 243-0292, Japan Kozo Watanabe, Department of Civil and Environmental Engineering, Ehime University, Bunkyo-cho 3, Matsuyama 790-8577, Japan Kazumi Tanida, Mikio Kato, Department of Biological Sciences, Graduate School of Science, Osaka Prefecture University, 1-1 Gakuencho, Naka-ku, Sakai 599-8531, Japan # Present address: Osaka Museum of Natural History, Nagai Park, Higashi-sumiyoshi, Osaka, 546-0034, Japan families within the orders but were useful in identifying species (i.e., DNA barcoding). In contrast, the more conserved 18S rRNA gene was adequately informative for elucidating inter-family divergence, but not suitable for species identification. Keywords: COI; gene phylogeny; histone; mayfly; rRNA; species identification 1 Introduction Aquatic insects comprise a taxonomically diverse community in rivers. Some taxonomic groups (taxa) are used as indicators for monitoring ecosystem health [1]. Despite their ecological importance, some groups (e.g., mayflies, Ephemeroptera) are often neglected in identification at the species-level in routine ecological assessments, and even in detailed research projects. Mayflies serve as indicators for ecological integrity because they are sensitive to environmental conditions such as water quality and flow characteristics [2-4]. Because of their small size, high abundance, diversity, and complex taxonomy, even experienced taxonomists find difficulty in species identification, especially when handling immature stages or damaged specimens. As an alternative to the classical identification based on morphological characters, DNA-based identification had been proposed [5] and DNA barcoding (originally proposed by Hebert et al. [6]) has become standard for characterizing a variety of taxonomic groups including mayflies. DNA barcoding uses a matching analysis of a short genetic marker (DNA barcode) to DNA databases of identified specimens. The utility and reliability of DNA barcoding depend upon the quality of DNA databases in which the annotated sequence data are registered. While 142 species of Japanese mayflies have been described from 39 genera in 13 families [7], only 17 species in 8 families of © 2016 Kei Wakimura, et al., published by De Gruyter Open. This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivs 3.0 License. K. Wakimura, et al. Japanese mayflies' DNA sequences appeared in GenBank/ EMBL/ DDBJ International DNA databases (http://www. ncbi.nlm.nih.gov/genbank/) when searched by the terms "Ephemeroptera" + "Japan" + NOT "Osaka Prefecture" (accessed 25 May, 2015). To accelerate DNA barcoding in surveying the mayfly biodiversity in the East Asian area, more annotated sequences must be registered to the databases. The present work aims to collect molecular data of East Asian mayflies from three genes that are widely used for taxonomic and evolutionary studies; a 658-bp partial coding region of cytochrome oxidase subunit I (COI) as suggested by Consortium for the Barcode of Life (CBOL, http://www.barcodeoflife.org/), a 328-bp partial coding region of histone 3 (H3), and a partial sequence of 18S rRNA (about 550-bp). All genes have been utilized to deduce the phylogenetic relationship among Ephemeroptera species [8]. For 18S rRNA, we chose the target region covering V4 and V5 stem-loop structures because of their high level of genetic variation within the order Ephemeroptera [9]. specimens, followed by a conventional proteinase-phenol extraction protocol [10]. Genitalia and heads parts were kept intact during dissection as voucher specimens, and stored in absolute ethanol. However, the genitalium of some small specimens was damaged during the isolation of sperm vesicles. For a few small specimens (e.g., Baetidae), a whole body was mashed in a micro-centrifuge tube prior to DNA extraction. All the information about the samples such as developmental stage, sex, date of collection, locality, by whom collected and identified, source organ for DNA isolation, and raw data of DNA sequencing were recorded. These are available from the corresponding author (Kato) upon request. DNA samples were stored in the refrigerator and insect specimens were kept at room temperature in absolute ethanol. All the samples used in this study are safely kept in the corresponding author's laboratory (Osaka Prefecture University) except those safely stored in Takemon's laboratory (Kyoto University) (specimen vouchers KU_Rj2008-60 ~ 69). 2 Materials and methods 2.1 Sample specimens We collected 303 specimens (109 imagoes, 148 nymphs, 46 subimagoes) from 80 taxa which were composed of 63 species, 14 genera (unidentified specific name), and 3 families (unidentified genus name) for sequencing analysis (Table 1). In total, there were 33 genera belonging to 11 families. These samples were collected from Honshu, Kyushu and Ryukyu Islands of Japan and Taiwan in the years of 1997-2014. Specimens were identified by the authors before DNA extraction. To avoid false-positive identification in DNA barcoding, only accurately identified specimens must be registered with full scientific names in the DNA databases. Therefore, taking a conservative approach, we did not assign scientific names to the specimens that could not be identified unambiguously due to damage or their early developmental stages. Fresh specimens were dissected to isolate DNA samples, while some were stored at -80°C, or in absolute ethanol at room temperature until the time of dissection. DNA was extracted from wing muscles at mid-thorax (imago/subimago females and males), sperm vesicles (imago/subimago males), hemolymph containing several types of somatic cells (nymphs), whole thorax (small individuals), or legs (relatively large individuals) of the 2.2 DNA analyses PCR was performed using a set of DNA primers designed for amplifying the target genes (Table 2), with either Sensizyme® HotStart Taq Premix (RBC Bioscience) or AmpliTaq Gold® 360 Master Mix (Life Technologies), depending on the availability. Amplified DNA fragments were purified using HiYieldTM Gel/PCR DNA Fragments Extraction Kit (RBC Bioscience) and sequenced from both forward and reverse directions using BigDye® Terminator v3.1 (Life Technologies) and an ABI3730xl DNA Analyzer (Applied Biosystems - Life Technologies). Forward and reverse sequencing reads were assembled, and aligned using BioEdit Sequence Alignment Editor version 7.1.3.0 [11]. Phylogenetic trees for each of the three genes were reconstructed based on the neighbor-joining method [12] using "Dnadist" with the option F84 model and "Neighbor" implemented in PHYLIP [13] with outgroup sequences (accession numbers: KC135891 for COI, AY870292 for histone H3, EF680326 for 18S rRNA). Tree topologies were examined by bootstrapping sequences of 1000 pseudoreplicates using "Seqboot" in PHYLIP. For the tree reconstructions, we used only sequence data that has a complete set of the three genes for simple comparison of tree topologies among different genes. Incomplete data sets (i.e., specimens of which only one or two genes out of three were determined) were not incorporated to the analysis. Table 1. Accession numbers of sequence data and source information. Stage imago imago imago nymph nymph nymph nymph nymph nymph nymph nymph imago imago imago nymph imago imago imago nymph nymph imago imago imago imago nymph nymph nymph nymph hemolymph hemolymph whole body hemolymph sperm vesicles sperm vesicles sperm vesicles sperm vesicles Nara, Japan Nara, Japan Nara, Japan Nara, Japan Okinawa, Japan Okinawa, Japan Okinawa, Japan Wakayama, Japan whole body Wakayama, Japan whole body Wakayama, Japan sperm vesicles Nara, Japan sperm vesicles Wakayama, Japan sperm vesicles Wakayama, Japan 26 Apr, 2009 26 Apr, 2009 26 Apr, 2009 5 May, 2012 5 May, 2012 8 May, 2010 8 May, 2010 27 Apr, 2013 27 Apr, 2013 23 Apr, 2012 23 Apr, 2012 23 Apr, 2012 15 May, 2011 KP970774 KP970775 KF562927 KF562928 KF562929 KP970811 JQ650162 wing muscle Wakayama, Japan 5 May, 2012 wing muscle Wakayama, Japan 5 May, 2012 wing muscle Nara, Japan 14 Apr, 2011 wing muscle Nara, Japan 14 Apr, 2011 JQ650183 JQ650184 KF562908 KF562938 GU354156 GU354157 GU354158 KF562941 KF562942 JQ650206 JQ650147 KF563003 KF563004 GU354162 KF563001 leg Kyoto, Japan 23 Feb, 2014 KP970797 JQ650159 JQ650120 leg Kyoto, Japan 23 Feb, 2014 KP970796 leg Kyoto, Japan 17 Feb, 2005 leg Kanagawa, Japan 25 Nov, 2011 KF562882 hemolymph Kanagawa, Japan 25 Nov, 2011 KF562880 KP970708 KF563023 KF563024 leg Kanagawa, Japan 25 Nov, 2011 KF562881 hemolymph Kanagawa, Japan 25 Nov, 2011 KF562879 KF563061 hemolymph Wakayama, Japan 15 May, 2011 KF562867 wing muscle Taiwan 27 Sep, 2011 JQ650221 wing muscle Taiwan 27 Sep, 2011 KF563028 sperm vesicles Taiwan 27 Sep, 2011 JQ650220 KF562953 KF563027 Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher OPU_BS_Eh2011-516 OPU_BS_Eh2011-517 OPU_BS_Eh2011-518 OPU_BS_Ey2011-168 OPU_BS_Ey2011-625 OPU_BS_Ey2011-626 OPU_BS_Ey2011-627 OPU_BS_Ey2011-628 OPU_BS_Bf2013-360 OPU_BS_Cg2014-14 OPU_BS_Cg2014-15 OPU_BS_C2011-90 OPU_BS_C2011-91 OPU_BS_C2012-130 OPU_BS_C2012-221 Cxx2009-20-Niugawa Cxx2009-21-Niugawa Family name Species name Heptageniidae Bleptus fasciatus Cinygmula grandifolia Cinygmula grandifolia XXX2009-27Oosako-U OPU_BS_Eb2012-229 OPU_BS_Eb2012-230 OPU_BS_Et2010-212 OPU_BS_Et2010-214 OPU_BS_Et2013-148 OPU_BS_Et2013-150 OPU_BS_Ev2012-197 OPU_BS_Ev2012-198 OPU_BS_Ev2012-199 OPU_BS_Ey2011-164 Ecdyonurus tigris Ecdyonurus tigris Ecdyonurus tobiironis Ecdyonurus tobiironis DNA barcodes of Japanese mayflies Ecdyonurus sp. Table 1. Accession numbers of sequence data and source information. Stage nymph nymph imago imago imago nymph subimago subimago subimago subimago imago nymph nymph imago imago imago subimago subimago imago imago imago imago subimago subimago subimago imago imago imago imago imago sperm vesicles sperm vesicles sperm vesicles sperm vesicles sperm vesicles wing muscle sperm vesicles wing muscle sperm vesicles sperm vesicles Nara, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Nara, Japan Nara, Japan Nara, Japan Nara, Japan Nara, Japan sperm vesicles Nara, Japan sperm vesicles Kyoto, Japan wing muscle Nara, Japan 8 May, 2010 Apr, 1997 14 Apr, 2011 14 Apr, 2011 25 Apr, 2004 25 Apr, 2010 25 Apr, 2010 25 Apr, 2010 14 Apr, 2011 14 Apr, 2011 14 Apr, 2011 14 Apr, 2011 14 Apr, 2011 JQ650172 EF680333 JQ650212 JQ650213 JQ650214 JQ650174 JQ650175 JQ650176 KF562869 JQ650177 JQ650131 JQ655115 JQ650119 JQ650130 KF563019 KF563020 KF563007 KF563008 sperm vesicles Nara, Japan 27 Apr, 2013 wing muscle Nara, Japan 27 Apr, 2013 sperm vesicles Nara, Japan 27 Apr, 2013 sperm vesicles Kanagawa, Japan 12 Sep, 2011 KP970762 KP970763 KP970764 JQ650207 EF680324 AY870289 JQ650128 JQ650118 AY870290 leg Kanagawa, Japan 12 Sep, 2011 JQ650217 KF563026 KP970686 KP970687 KF563017 leg Kanagawa, Japan 12 Sep, 2011 JQ650216 wing muscle Nara, Japan 27 Apr, 2013 JQ650163 sperm vesicles Nara, Japan 27 Apr, 2013 sperm vesicles Nara, Japan 27 Apr, 2013 KP970769 wing muscle Nara, Japan 27 Apr, 2013 KP970768 wing muscle Nara, Japan 27 Apr, 2013 KP970767 whole body Wakayama, Japan 5 May, 2012 KP970810 KP970754 KP970690 KP970691 KP970692 KP970693 KP970696 wing muscle Wakayama, Japan 5 May, 2012 KF562876 wing muscle Wakayama, Japan 5 May, 2012 KF562910 wing muscle Wakayama, Japan 5 May, 2012 KF562909 hemolymph Fukuoka, Japan Apr, 2012 KF562923 hemolymph Fukuoka, Japan Apr, 2012 KF562922 Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher OPU_BS_E2012-190 OPU_BS_E2012-191 OPU_BS_E2012-131 OPU_BS_E2012-133 OPU_BS_E2012-132 OPU_BS_E2012-225 OPU_BS_E2013-71 OPU_BS_E2013-72 OPU_BS_E2013-74 OPU_BS_E2013-76 OPU_BS_E2013-130 OPU_BS_E2011-513 OPU_BS_E2011-514 OPU_BS_E2011-515 OPU_BS_Ea2013-55 OPU_BS_Ea2013-57 OPU_BS_Ea2013-58 OPU_BS_Ec2010-226 EI1997Kibune OPU_BS_Ei2011-1 OPU_BS_Ei2011-2 EL2004Niugawa38 OPU_BS_El2010-4 OPU_BS_El2010-7 OPU_BS_El2010-8 OPU_BS_El2011-20 OPU_BS_El2011-21 OPU_BS_El2011-22 OPU_BS_El2011-23 OPU_BS_El2011-24 Family name Species name Ecdyonurus sp. Ecdyonurus sp. Ecdyonurus sp. K. Wakimura, et al. Ecdyonurus sp. Ecdyonurus sp. Ecdyonurus sp. Ecdyonurus sp. Ecdyonurus sp. Ecdyonurus sp. Ecdyonurus sp. Ecdyonurus sp. Epeorus curvatulus Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Table 1. Accession numbers of sequence data and source information. Stage imago imago imago imago imago imago imago subimago subimago subimago subimago subimago imago imago imago nymph nymph nymph nymph nymph nymph imago imago imago imago imago imago imago nymph wing muscle sperm vesicles wing muscle whole body wing muscle sperm vesicles wing muscle sperm vesicles Nara, Japan Kyoto, Japan Kyoto, Japan Kyoto, Japan Kyoto, Japan Kyoto, Japan Kyoto, Japan Nara, Japan hemolymph Shiga, Japan whole body Nara, Japan whole body Nara, Japan whole body Nara, Japan whole body Nara, Japan 14 Dec, 2012 14 Dec, 2012 14 Dec, 2012 14 Dec, 2012 Mar, 2012 9 May, 2009 27 Apr, 2008 27 Apr, 2008 27 Apr, 2008 27 Apr, 2008 27 Apr, 2008 27 Apr, 2008 14 Dec, 2012 KF562894 KF562976 KF562875 GU354160 whole body Nara, Japan 14 Dec, 2012 sperm vesicles Nara, Japan 9 May, 2009 leg Wakayama, Japan 11 May, 2014 GU354159 KF562896 KF562897 KF562898 KP970812 KP970755 KP970756 GU354164 JQ319378 JQ319379 JQ319380 JQ319381 JQ319382 JQ319383 leg Wakayama, Japan 11 May, 2014 wing muscle Nara, Japan 27 Apr, 2013 sperm vesicles Nara, Japan 27 Apr, 2013 KP970761 KP970700 KP970713 KP970714 GU354163 wing muscle Nara, Japan 27 Apr, 2013 KP970760 wing muscle Nara, Japan 27 Apr, 2013 KP970759 wing muscle Nara, Japan 27 Apr, 2013 KP970758 sperm vesicles Nara, Japan 14 Apr, 2011 JQ650157 sperm vesicles Nara, Japan 14 Apr, 2011 JQ650156 KF563022 sperm vesicles Nara, Japan 14 Apr, 2011 JQ650155 sperm vesicles Nara, Japan 14 Apr, 2011 KF562872 sperm vesicles Nara, Japan 14 Apr, 2011 JQ650178 JQ650132 wing muscle Nara, Japan 14 Apr, 2011 KF562871 JQ650154 wing muscle Nara, Japan 14 Apr, 2011 KF562870 Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher OPU_BS_El2011-25 OPU_BS_El2011-26 OPU_BS_El2011-27 OPU_BS_El2011-28 OPU_BS_El2011-29 OPU_BS_El2011-30 OPU_BS_El2011-56 OPU_BS_El2013-1 OPU_BS_El2013-2 OPU_BS_El2013-4 OPU_BS_El2013-5 OPU_BS_El2013-143 OPU_BS_El2014-1 OPU_BS_El2014-2 Family name Species name Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Epeorus latifolium Ena2009-125Sannokou OPU_BS_En2012-251 OPU_BS_En2012-252 OPU_BS_En2012-253 OPU_BS_E2012-235 OPU_BS_E2012-236 OPU_BS_Hk2012-24 Epeorus sp. Epeorus sp. Heptagenia kihada Proepeorus nipponicus Rhithrogena japonica Eni2009-131Nakaigawa KU_Rj2008-63 KU_Rj2008-64 KU_Rj2008-65 KU_Rj2008-67 KU_Rj2008-68 KU_Rj2008-69 OPU_BS_Rj2012-241 Rhithrogena japonica Rhithrogena japonica DNA barcodes of Japanese mayflies Rhithrogena japonica Rhithrogena japonica Rhithrogena japonica Rhithrogena japonica Table 1. Accession numbers of sequence data and source information. Stage nymph imago imago imago imago imago imago imago nymph nymph nymph imago imago subimago nymph nymph imago subimago subimago subimago subimago subimago imago imago imago imago imago imago imago sperm vesicles sperm vesicles wing muscle sperm vesicles sperm vesicles sperm vesicles wing muscle wing muscle wing muscle wing muscle Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan wing muscle Wakayama, Japan sperm vesicles Wakayama, Japan sperm vesicles Nara, Japan 25 Apr, 2009 24 Apr, 2010 24 Apr, 2010 24 Apr, 2010 24 Apr, 2010 24 Apr, 2010 5 May, 2012 5 May, 2012 5 May, 2012 5 May, 2012 5 May, 2012 5 May, 2012 5 May, 2012 KF562877 KF562914 KF562911 KF562912 KF562913 KF562962 KF562964 KF562965 KF562966 KF562967 KF562968 KF562969 JQ650203 JQ650146 leg Saitama, Japan 6 Dec, 2008 leg Saitama, Japan 6 Dec, 2008 wing muscle Kanagawa, Japan 16 Nov, 2011 wing muscle Kanagawa, Japan 16 Nov, 2011 JQ650198 KP970786 KP970787 GU354153 JQ650202 KF563012 KF563013 KF563010 KF563014 GQ433997 sperm vesicles Kanagawa, Japan 16 Nov, 2011 whole body Okinawa, Japan 23 Apr, 2012 KF562936 JQ650139 JQ650140 JQ650141 KP970706 KP970707 whole body Okinawa, Japan 22 Apr, 2012 KF562935 hemolymph Okinawa, Japan 22 Apr, 2012 KF562934 sperm vesicles Nara, Japan 25 Apr, 2009 GU354149 KF563058 sperm vesicles Nara, Japan 25 Apr, 2009 GU354148 sperm vesicles Nara, Japan 25 Apr, 2009 GU354147 sperm vesicles Wakayama, Japan 25 Apr, 2004 EF680332 AY850372 sperm vesicles Wakayama, Japan 24 Apr, 2005 JQ319386 sperm vesicles Wakayama, Japan 24 Apr, 2005 JQ319385 sperm vesicles Wakayama, Japan 24 Apr, 2005 JQ319384 whole body Nara, Japan 14 Dec, 2012 KF562895 KF562977 OPU_Rj2005-02 OPU_Rj2005-07 OPU_Rj2005-10 RJ2004Niugawa1 Rja2009-01-Oosako-U Rja2009-02-Oosako-U Rja2009-03-Oosako-U OPU_BS_Rm2012-216 OPU_BS_Rm2012-217 OPU_BS_Rm2012-218 OPU_BS_Rt2011-601 OPU_BS_Rt2011-602 OPU_BS_Rt2011-603 OPU_BS_Rt2013-358 OPU_BS_Rt2013-359 Rxx2009-08-Oosako-U OPU_BS_R2010-11 OPU_BS_R2010-15 OPU_BS_R2010-16 OPU_BS_R2010-12 OPU_BS_R2010-19 OPU_BS_R2012-102 OPU_BS_R2012-153 OPU_BS_R2012-154 OPU_BS_R2012-155 OPU_BS_R2012-156 OPU_BS_R2012-157 OPU_BS_R2012-158 Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher OPU_BS_Rj2012-242 Family name Species name Rhithrogena japonica Rhithrogena japonica Rhithrogena japonica K. Wakimura, et al. Rhithrogena japonica Rhithrogena japonica Rhithrogena japonica Rhithrogena japonica Rhithrogena japonica Rhithrogena tetrapunctigera Rhithrogena tetrapunctigera Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Rhithrogena sp. Table 1. Accession numbers of sequence data and source information. Stage imago subimago subimago subimago imago nymph nymph nymph imago imago nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph hemolymph whole body hemolymph whole body hemolymph wing muscle whole body wing muscle wing muscle wing muscle Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Kanagawa, Japan Kanagawa, Japan Nara, Japan Wakayama, Japan wing muscle Fukuoka, Japan hemolymph Fukuoka, Japan hemolymph Fukuoka, Japan hemolymph Fukuoka, Japan 16 Apr, 2012 16 Apr, 2012 16 Apr, 2012 16 Apr, 2012 5 May, 2012 5 May, 2012 5 May, 2012 15 May, 2011 5 May, 2012 15 May, 2011 Mar, 2012 Mar, 2012 14 May, 2011 15 May, 2011 KP970807 KP970808 KP970809 KF562866 KF562937 KF562868 KF562902 KF562903 JQ650193 KP970806 KF562989 KF562990 KP970750 KF563040 KF563041 KP970751 KP970752 KP970753 JQ650124 KF563000 hemolymph Fukuoka, Japan 16 Apr, 2012 hemolymph Kanagawa, Japan Mar, 2012 hemolymph Kanagawa, Japan Mar, 2012 hemolymph Kanagawa, Japan Mar, 2012 hemolymph Kanagawa, Japan Mar, 2012 KF562886 hemolymph Kanagawa, Japan Mar, 2012 KF562885 wing muscle Nara, Japan 15 Apr, 2011 wing muscle Nara, Japan 15 Apr, 2011 JQ650189 JQ650161 KF563005 KF562974 hemolymph Nara, Japan 14 May, 2011 JQ650195 JQ650127 KF563033 KF563034 KF563035 KF563036 KF563037 KF563042 KF563043 KF563044 KF563045 KF563046 hemolymph Nara, Japan 14 May, 2011 JQ650194 JQ650126 hemolymph Wakayama, Japan 15 May, 2011 JQ650218 wing muscle Nara, Japan 8 May, 2010 JQ650210 sperm vesicles Nara, Japan 15 Apr, 2011 JQ650191 JQ650123 sperm vesicles Nara, Japan 15 Apr, 2011 JQ650186 JQ650121 wing muscle Nara, Japan 15 Apr, 2011 JQ650185 JQ650136 OPU_BS_Ce2011-98 OPU_BS_Ce2011-99 OPU_BS_Ce2011-128 OPU_BS_Cn2010-363 OPU_BS_ Cn2011-171 OPU_BS_Cn2011-308 OPU_BS_Co2011-309 OPU_BS_C2011-113 OPU_BS_C2011-117 OPU_BS_Db2012-1 OPU_BS_Db2012-2 OPU_BS_Db2012-5 OPU_BS_Db2012-6 OPU_BS_Db2012-7 OPU_BS_Db2012-100 OPU_BS_Db2012-101 OPU_BS_Db2012-160 OPU_BS_Db2012-161 OPU_BS_Db2012-164 OPU_BS_D2012-222 OPU_BS_D2012-223 OPU_BS_D2012-224 OPU_BS_Di2011-165 OPU_BS_Dk2012-220 OPU_BS_Di2011-170 OPU_BS_Ds2012-54 OPU_BS_Ds2012-55 OPU_BS_Dt2011-255 OPU_BS_D2011-166 wing muscle Wakayama, Japan 28 Apr, 2013 KP970781 OPU_BS_H2013-235 Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher Family name Species name Heptageniidae sp. Ephemerellidae Cincticostella orientalis Cincticostella sp. Cincticostella sp. Drunella basalis Drunella basalis Drunella basalis Drunella basalis Drunella basalis Drunella basalis Drunella basalis Drunella basalis Drunella basalis Drunella basalis Drunella ishiyamana Drunella kohnoi DNA barcodes of Japanese mayflies Drunella trispina Table 1. Accession numbers of sequence data and source information. Stage nymph nymph nymph nymph nymph nymph nymph hemolymph hemolymph whole body hemolymph hemolymph whole body leg leg leg leg sperm vesicles hemolymph hemolymph hemolymph wing muscle sperm vesicles abdomen abdomen abdomen abdomen abdomen abdomen whole body Nara, Japan Osaka, Japan Osaka, Japan Osaka, Japan Osaka, Japan Osaka, Japan Osaka, Japan Nara, Japan Kyushu, Japan Wakayama, Japan Kyushu, Japan Kyushu, Japan Nara, Japan 25 Apr, 2009 Mar, 2012 Mar, 2012 Mar, 2012 5 May, 2012 27 Apr, 2013 29 Jun, 2014 29 Jun, 2014 29 Jun, 2014 29 Jun, 2014 29 Jun, 2014 29 Jun, 2014 15 May, 2011 KP970802 KP970803 KP970804 JQ650125 KP970728 KP970800 KP970801 KF562905 Kyoto, Japan 13 Apr, 2014 Kyoto, Japan 13 Apr, 2014 GU354155 KF562904 KF562991 KF562959 KF562992 KF562963 KP970729 KP970725 KP970726 KP970727 KF563051 KF563053 KF563054 Kyoto, Japan 11 Apr, 2014 Kyoto, Japan 11 Apr, 2014 KP970798 KP970799 KP970723 KP970724 Kanagawa, Japan Mar, 2012 Kanagawa, Japan Mar, 2012 KF562893 Kanagawa, Japan Mar, 2012 KF562892 Shiga, Japan Mar, 2012 KF562889 KF562984 KF562986 KF562987 KF562988 KP970722 Shiga, Japan Mar, 2012 KF562888 KF562983 Shiga, Japan Mar, 2012 KF562887 KF562982 KF563038 KF563039 KF563052 nymph nymph nymph nymph nymph nymph nymph nymph nymph imago nymph nymph nymph imago imago nymph nymph nymph nymph nymph nymph nymph hemolymph Fukuoka, Japan 15 Apr, 2012 KF562921 hemolymph Fukuoka, Japan 15 Apr, 2012 KF562920 KF563050 hemolymph Fukuoka, Japan 15 Apr, 2012 KF562919 KF563049 hemolymph Fukuoka, Japan 15 Apr, 2012 KF562918 KF563048 hemolymph Fukuoka, Japan 15 Apr, 2012 KF562917 hemolymph Kanagawa, Japan Mar, 2012 KF562907 KF562961 wing muscle Kanagawa, Japan Mar, 2012 KF562906 KF562960 KF563055 Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher OPU_BS_D2012-96 OPU_BS_D2012-97 OPU_BS_D2012-178 OPU_BS_D2012-179 OPU_BS_D2012-180 OPU_BS_D2012-181 OPU_BS_D2012-182 OPU_BS_El2012-18 OPU_BS_Ea2012-33 OPU_BS_Ea2012-34 OPU_BS_Ea2012-43 OPU_BS_Ea2012-44 OPU_BS_Ea2012-45 OPU_BS_En2014-17 OPU_BS_En2014-18 OPU_BS_En2014-22 OPU_BS_En2014-23 Exx2009-16-Ootaki-D OPU_BS_E2012-86 OPU_BS_E2012-90 OPU_BS_E2012-91 OPU_BS_E2012-129 OPU_BS_E2013-51 OPU_BS_E2014-68 OPU_BS_E2014-69 OPU_BS_E2014-71 OPU_BS_E2014-72 OPU_BS_E2014-73 OPU_BS_E2014-76 OPU_BS_Ss2011-167 Family name Species name K. Wakimura, et al. Ephacerella longicaudata nymph Ephemerella sp. Ephemerella sp. Ephemerella sp. Ephemerella sp. Ephemerella sp. Ephemerella sp. Ephemerella sp. Ephemerella sp. Ephemerella sp. Ephemerella sp. Ephemerella sp. Ephemerella sp. Serratella setigera Table 1. Accession numbers of sequence data and source information. Stage nymph nymph nymph nymph nymph nymph nymph nymph subimago subimago subimago subimago nymph nymph nymph subimago nymph subimago subimago subimago subimago subimago subimago nymph nymph nymph imago imago wing muscle whole body sperm vesicles whole body whole body wing muscle sperm vesicles wing muscle Wakayama, Japan Wakayama, Japan Wakayama, Japan Kanagawa, Japan Kanagawa, Japan Nara, Japan Nara, Japan Wakayama, Japan sperm vesicles Wakayama, Japan wing muscle Nara, Japan wing muscle Nara, Japan whole body Kanagawa, Japan 9 Nov, 2011 27 Apr, 2013 27 Apr, 2013 24 Apr, 2010 24 Apr, 2010 24 Apr, 2010 24 Apr, 2010 9 Nov, 2011 16 Nov, 2011 14 Dec, 2012 25 Apr, 2009 24 Apr, 2010 JQ650200 KF562900 GU354152 JQ655111 JQ650211 JQ650149 JQ650150 JQ650151 KF562972 KF562973 KF563016 KF563030 KF563031 thorax Nara, Japan 27 Apr, 2013 whole body Nara, Japan 14 Dec, 2012 KF562874 KP970697 KP970698 KF563015 abdomen Kyoto, Japan 20 Sep, 2010 thorax Kyoto, Japan 20 Sep, 2010 KP970788 KP970789 KF562899 KP970739 KF562980 leg Wakayama, Japan 11 May, 2014 wing muscle Nara, Japan 27 Apr, 2013 KP970779 KP970715 KP970709 KP970710 KP970701 wing muscle Nara, Japan 27 Apr, 2013 KP970778 wing muscle Nara, Japan 27 Apr, 2013 KP970777 sperm vesicles Nara, Japan 25 Apr, 2009 GU354154 GQ433998 leg Okayama, Japan 16 Sep, 2012 KP970785 leg Okayama, Japan 16 Sep, 2012 KP970784 KP970738 KP970704 KP970705 hemolymph Okinawa, Japan 22 Apr, 2012 KF562926 KF562995 hemolymph Okinawa, Japan 22 Apr, 2012 KF562925 whole body Taiwan Sep, 2011 KF562957 whole body Taiwan Sep, 2011 KF562873 KF562956 JQ655119 whole body Wakayama, Japan 16 Nov, 2011 JQ650199 JQ650142 JQ655113 Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher OPU_BS_Es2011-605 OPU_BS_Tb2011-542 OPU_BS_Tb2011-543 OPU_BS_Tj2012-193 OPU_BS_Tj2012-194 OPU_BS_Uc2013-356 OPU_BS_Uc2013-357 Uru2009-10-Oosako-D OPU_BS_E2013-167 OPU_BS_E2013-168 OPU_BS_E2013-169 OPU_BS_E2014-4 OPU_BS_Ag2013-361 OPU_BS_Ag2013-362 OPU_BS_As2012-254 OPU_BS_As2013-145 OPU_BS_Ay2011-566 OPU_BS_Ay2013-131 OPU_BS_Ay2013-132 OPU_BS_Bj2010-38 OPU_BS_Bj2010-39 OPU_BS_Bj2010-40 OPU_BS_Bj2010-41 OPU_BS_Bt2011-564 OPU_BS_Bt2011-606 OPU_BS_Bt2012-261 Bxx2009-07-Oosako-U OPU_BS_B2010-23 9 Family name Species name Serratella setigera Teloganopsis brocha Teloganopsis brocha Torleya japonica Torleya japonica Uracanthella chinoi Uracanthella chinoi Uracanthella punctisetae Baetidae Acentrella gnom Acentrella gnom Acentrella sibirica Acentrella sibirica DNA barcodes of Japanese mayflies Baetis sp. Baetis sp. Table 1. Accession numbers of sequence data and source information. Stage imago imago imago imago imago imago subimago subimago imago subimago subimago imago nymph nymph nymph nymph nymph nymph nymph nymph nymph imago imago imago imago nymph nymph nymph sperm vesicles whole body whole body whole body wing muscle Taiwan Taiwan Miyagi, Japan Miyagi, Japan Miyagi, Japan leg leg thorax Kyoto, Japan Wakayama, Japan Wakayama, Japan thorax Kyoto, Japan whole body Kanagawa, Japan whole body Kanagawa, Japan whole body Wakayama, Japan 5 May, 2012 25 Nov, 2011 25 Nov, 2011 20 Sep, 2010 20 Sep, 2010 11 May, 2014 11 May, 2014 Sep, 2011 Sep, 2011 8 Aug, 2010 8 Aug, 2010 8 Aug, 2010 JQ650223 JQ650224 JQ650164 JQ650167 JQ650168 JQ650169 JQ655117 whole body Wakayama, Japan 5 May, 2012 thorax Chiba, Japan 9 May, 2009 thorax Chiba, Japan 9 May, 2009 KP970782 KF562940 KF562939 KF562884 KF562883 KP970790 KP970791 KP970740 KP970741 KP970711 KP970712 KP970716 KP970717 whole body Kanagawa, Japan 24Nov, 2011 KF562878 KP970734 KP970735 KF562975 KF563002 thorax Nara, Japan 27 Apr, 2013 KP970776 wing muscle Nara, Japan 27 Apr, 2013 sperm vesicles Nara, Japan 27 Apr, 2013 KP970771 KP970699 KF563032 KF563060 KF563059 wing muscle Nara, Japan 27 Apr, 2013 KP970770 wing muscle Nara, Japan 27 Apr, 2013 thorax Nara, Japan 27 Apr, 2013 whole body Nara, Japan 14 May, 2011 KF562950 wing muscle Nara, Japan 15 Apr, 2011 JQ650192 JQ650138 JQ655116 KP970694 KP970695 sperm vesicles Nara, Japan 14 Apr, 2011 JQ650182 JQ650158 wing muscle Nara, Japan 14 Apr, 2011 JQ650173 JQ650129 wing muscle Wakayama, Japan 24 Apr, 2010 JQ650208 wing muscle Wakayama, Japan 24 Apr, 2010 JQ655112 Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher Family name Species name Baetis sp. Baetis sp. OPU_BS_B2010-23 clone 2 OPU_BS_B2010-24 OPU_BS_B2011-19 OPU_BS_B2011-74 OPU_BS_B2011-147 OPU_BS_B2011-494 OPU_BS_B2013-85 OPU_BS_B2013-101 OPU_BS_B2013-102 OPU_BS_B2013-103 OPU_BS_B2013-134 OPU_BS_B2013-166 OPU_BS_La2011-614 OPU_BS_Lt2013-352 OPU_BS_Lt2013-353 OPU_BS_Nc2012-227 OPU_BS_N2012-226 OPU_BS_Bt2011-607 OPU_BS_Bt2011-608 OPU_BS_Tf2013-363 OPU_BS_Tf2013-364 OPU_BS_B2014-5 OPU_BS_B2014-6 OPU_BS_Ef2011-525 OPU_BS_Ef2011-526 OPU_BS_Ej2010-EJ1 OPU_BS_Ej2010-EJ2 OPU_BS_Ej2010-EJ3 Baetis sp. K. Wakimura, et al. Baetis sp. Baetis sp. Baetis sp. Baetis sp. Baetis sp. Baetis sp. Baetis sp. Baetis sp. Baetis sp. Labiobaetis atrebatinus orientalis Labiobaetis tricolor Labiobaetis tricolor Nigrobaetis chocoratus Nigrobaetis sp. D Nigrobaetis taiwanensis Nigrobaetis taiwanensis Tenuibaetis flexifemora Tenuibaetis flexifemora Baetidae sp. Baetidae sp. Ephemeridae Ephemera formosana Ephemera formosana Ephemera japonica Ephemera japonica Ephemera japonica Table 1. Accession numbers of sequence data and source information. Stage nymph nymph nymph nymph nymph nymph nymph nymph nymph nymph imago imago imago imago nymph nymph nymph nymph sperm vesicles sperm vesicles sperm vesicles wing muscle sperm vesicles sperm vesicles sperm vesicles sperm vesicles whole body whole body whole body Wakayama, Japan Wakayama, Japan Wakayama, Japan Wakayama, Japan Nara, Japan Nara, Japan Kanagawa, Japan Kanagawa, Japan Kanagawa, Japan Nara, Japan Nara, Japan whole body Taiwan Sep, 2011 25 Apr, 2009 25 Apr, 2009 24 Apr, 2010 24 Apr, 2010 9 Apr, 2006 9 Apr, 2006 14 Apr, 2011 14 Apr, 2011 12 Sep, 2011 12 Sep, 2011 12 Sep, 2011 JQ650219 JQ650180 JQ650181 JQ650204 JQ650205 GU354146 whole body Taiwan Sep, 2011 whole body Miyagi, Japan 8 Aug, 2010 JQ650225 whole body Miyagi, Japan 8 Aug, 2010 sperm vesicles Nara, Japan 25 Apr, 2009 GU354151 JQ650170 JQ650171 JQ650165 JQ650166 GQ433999 GQ434000 JQ650144 JQ650145 EF055451 JQ650134 JQ650135 KF562951 KF562952 KF563011 GU354161 JQ655114 JQ655118 sperm vesicles Kyoto, Japan sperm vesicles Kyoto, Japan EF680329 AY860841 sperm vesicles Kyoto, Japan EF680328 wing muscle Shiga, Japan Mar, 2012 KF562891 KF562958 wing muscle Shiga, Japan Mar, 2012 KF562890 KF562985 wing muscle Fukushima, Japan 11 Sep, 2011 KF562948 wing muscle Fukushima, Japan 11 Sep, 2011 KF562947 wing muscle Fukushima, Japan 11 Sep, 2011 KF562946 wing muscle Fukushima, Japan 11 Sep, 2011 KF562945 wing muscle Fukushima, Japan 11 Sep, 2011 KF562944 wing muscle Fukushima, Japan 11 Sep, 2011 KF562943 hemolymph Kanagawa, Japan 12 Sep, 2011 JQ650197 whole body Kanagawa, Japan 12 Sep, 2011 JQ650153 Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher OPU_BS_Ej2011-507 OPU_BS_Ej2011-508 OPU_BS_Ej2012-265 OPU_BS_Ej2012-266 OPU_BS_Ej2012-267 OPU_BS_Ej2012-268 OPU_BS_Ej2012-269 OPU_BS_Ej2012-270 OPU_BS_Eo2012-35 OPU_BS_Eo2012-36 ES2002Kyoto1 ES2002Kyoto2 ES2002Kyoto Est2009-06-Oosako-U OPU_BS_Es2010-ES2 OPU_BS_Es2010-ES3 OPU_BS_Cn2011-534 OPU_BS_Cn2011-539 Pch2009-17-Ootaki-D Pch2009-18-Ootaki-D OPU_BS_Pj2010-13 OPU_BS_Pj2010-14 PS2006Niugawa-1 PS2006Niugawa 1-2-3 OPU_BS_Ps2011-41 OPU_BS_Ps2011-42 OPU_BS_Pw2011-495 OPU_BS_Pw2011-496 OPU_BS_Pw2011-502 Family name Species name Ephemera japonica Ephemera japonica Ephemera japonica Ephemera japonica Ephemera japonica Ephemera japonica Ephemera japonica Ephemera japonica Ephemera orientalis Ephemera orientalis Leptophlebiidae Choroterpides nigella Choroterpides nigella Paraleptophlebia chocolataimago Paraleptophlebia chocolataimago Paraleptophlebia japonica subimago Paraleptophlebia japonica subimago DNA barcodes of Japanese mayflies Table 1. Accession numbers of sequence data and source information. Stage wing muscle wing muscle whole body whole body wing muscle wing muscle sperm vesicles sperm vesicles hemolymph hemolymph hemolymph whole body sperm vesicles wing muscle wing muscle sperm vesicles ovary wing muscle wing muscle sperm vesicles wing muscle wing muscle wing muscle whole body leg hemolymph leg Nara, Japan Wakayama, Japan Wakayama, Japan Nara, Japan Nara, Japan Nara, Japan Kyoto, Japan Fukuoka, Japan Kyoto, Japan Nara, Japan Nara, Japan Nara, Japan 25 Apr, 2009 25 Apr, 2009 27 Apr, 2013 27 Apr, 2013 24 Apr, 2010 24 Apr, 2010 15 Apr, 2011 15 Apr, 2010 14 Dec, 2012 11 Apr, 2014 15 Apr, 2012 11 Apr, 2014 Nara, Japan 15 Apr, 2011 Nara, Japan 14 Apr, 2011 Kyoto, Japan Apr, 1997 EF680323 JQ650179 JQ650188 GU354150 KP970765 KP970766 JQ650215 JQ650201 JQ650187 JQ650190 KF562901 KF562924 KP970795 Okinawa, Japan 23 Apr, 2012 KF562933 Okinawa, Japan 23 Apr, 2012 KF562932 Okinawa, Japan 23 Apr, 2012 KF562931 Okinawa, Japan 23 Apr, 2012 KF562930 KF562996 KF562997 KF562998 KF562999 AY870291 JQ650133 JQ650160 GQ433995 GQ433996 KP970730 JQ650152 JQ650143 JQ650137 JQ650122 KF562981 KP970747 KF562994 KP970748 KF563056 KF563009 KP970688 KP970689 KF563021 KF563057 Wakayama, Japan 28 Apr, 2013 KP970780 KP970733 Wakayama, Japan 28 Apr, 2013 KP970732 Nara, Japan 27 Apr, 2013 KP970773 KP970731 Nara, Japan 27 Apr, 2013 KP970772 Nara, Japan 14 Dec, 2012 KF562979 Nara, Japan 14 Dec, 2012 KF562978 Nara, Japan 8 May, 2010 JQ650209 JQ650148 KF563018 Kanagawa, Japan 12 Sep, 2011 JQ650196 KF563025 subimago nymph nymph imago subimago imago subimago nymph nymph nymph nymph imago imago imago imago imago subimago subimago imago imago imago subimago nymph nymph nymph nymph Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher OPU_BS_Pw2011-504 OPU_BS_P2010-362 OPU_BS_P2012-248 OPU_BS_P2012-249 OPU_BS_P2013-105 OPU_BS_P2013-106 OPU_BS_P2013-200 OPU_BS_P2013-202 OPU_BS_Tg2012-210 OPU_BS_Tg2012-211 OPU_BS_Tg2012-212 OPU_BS_Tg2012-214 AC1997Kibune-O OPU_BS_Ac2011-38 OPU_BS_Ac2011-108 Family name Species name Paraleptophlebia westoni imago K. Wakimura, et al. Ameletidae Amo2009-04Oosako-U Amo2009-05Oosako-U OPU_BS_Am2013-67 OPU_BS_Am2013-68 OPU_BS_A2010-9 OPU_BS_A2010-10 OPU_BS_A2011-106 OPU_BS_A2011-122 OPU_BS_A2012-262 OPU_BS_A2014-12 OPU_BS_Pf2012-192 OPU_BS_Pf2014-13 Potamanthidae Table 1. Accession numbers of sequence data and source information. Stage imago imago imago nymph nymph nymph nymph nymph nymph nymph nymph imago nymph nymph nymph thorax Okayama, Japan thorax Okayama, Japan 16 Sep, 2011 16 Sep, 2011 KP970783 wing muscle Wakayama, Japan 15 May, 2011 whole body Nara, Japan 14 May, 2011 KP970805 KF562949 leg Kyoto, Japan 11 Apr, 2014 KP970757 KF563006 KP970736 KP970737 leg Kyoto, Japan 11 Apr, 2014 leg Kyoto, Japan 11 Apr, 2014 KP970794 KP970744 KP970745 KP970746 leg Kyoto, Japan 11 Apr, 2014 KP970793 KP970743 leg Kyoto, Japan 11 Apr, 2014 KP970792 KP970742 hemolymph Fukuoka, Japan 16 Apr, 2012 KF562971 hemolymph Fukuoka, Japan 16 Apr, 2012 KF562916 KF562993 KF563047 KP970718 KP970719 KP970720 KP970721 KP970702 KP970703 wing muscle Fukuoka, Japan 16 Apr, 2012 KF562915 KF562970 wing muscle Taiwan Sep, 2011 KF562955 KF563029 sperm vesicles Taiwan Sep, 2011 JQ650222 KF562954 leg Nara, Japan 6 Jul, 2014 KP970749 OPU_BS_Pf2014-77 OPU_BS_Pi2011-521 OPU_BS_Pi2011-522 OPU_BS_Ss2012-174 OPU_BS_Ss2012-175 OPU_BS_Ss2012-176 OPU_BS_S2014-7 OPU_BS_S2014-8 OPU_BS_S2014-9 OPU_BS_S2014-10 OPU_BS_S2014-11 OPU_BS_C2011-493 OPU_BS_Ij2011-169 OPU_BS_Es2013-354 OPU_BS_Es2013-355 DNA barcodes of Japanese mayflies Source tissue Location Collection Date 18S rRNA Histone H3 COI Specimen voucher Family name Species name Potamanthus idiocerus Potamanthus idiocerus Siphlonuridae Caenidae Caenis sp. Isonychiidae Isonychia japonica Polymitarcyidae Ephoron shigae Ephoron shigae K. Wakimura, et al. Table 2. DNA primers used for PCR and sequencing analysis. Primer name HexAF HexAR LCO1490 HCO2198 KOBO18SF1 KOBO18SR1 Sequence atggctcgtaccaagcagacggc atatccttgggcatgatggtgac ggtcaacaaatcataaagatattgg taaacttcagggtgaccaaaaaatca tggcgtatattaaagttgttgcggt agtttcagctttgcaaccatacttc V4 and V5 region of 18S rRNA 55°C Kobori et al., unpublished. cytochrome oxidase subunit 1 45°C Folmer et al. [19] Target histone H3 Annealing temperature 55°C Reference Ogden & Whiting [18] 3 Results and discussion A total of 486 sequences data (118 of COI, 214 of 18S rRNA, and 154 of histone H3) have been deposited in GenBank/ EMBL/ DDBJ International Nucleotide Databases, from which they can be retrieved using the search terms "Ephemeroptera" + "Osaka Prefecture" + gene name. Accession numbers of sequence data are listed on Table 1. Lack of an accession number means the sequence was not determined. Some of them were difficult to amplify by PCR under the conditions indicated, and some were postponed because of lower priority of analysis (large effort was made to analyze the unsequenced species). A portion of the DNA sequences (98 among 486 sequences) were not registered with full scientific names due to our conservative way of identification, thus were not applicable to DNA barcoding at the species level. However, their registration with precise information on sampling locations and time (year/ month) is still beneficial for ecological and conservation studies. Comparing with sequence data from undoubtedly identified specimens, which was already registered in the database or will be registered in the course of future studies, the sequences from our ambiguous specimens may be used in the estimation of habitat range and its temporal change. In the phylogenetic trees of COI and H3, the family Heptageniidae was divided into three distant clusters or singletons (Figs. 1A and 1B). This could be the result of long branch attraction [14] due to the highly variable nature of these genes, or saturation of substitutions at the third positions of codons [15]. The low levels of support for the estimated phylogenetic relationships at higher taxonomic levels (i.e., family and genus), however, does not lessen the validity of species-level identification [16,17]. The 18S rRNA tree showed monophyletic clustering of families (Fig. 1C) when the highly variable V4 stem-loop regions (containing many insertions/deletions that were impossible to align unambiguously) were excluded from the analysis. The specimen of Nigrobaetis sp. D (N2012-226) was recovered in its expected position as sister-group to Nigrobaetis chocoratus (Nc2012-227) in both the COI and 18S trees (Fig. 1A and Fig. 1C) but in the histone H3 tree (Fig. 1B) it is placed well within a clade comprising Empherellidae specimens, as sister-group to Ephemeralla sp. (E2012-86). It is possible that we amplified a paralogous copy of the histone H3 gene in this instance, or that there might have been cross-contamination of samples, however as we do not have any further specimens of Nigrobaetis sp. D we cannot test this hypothesis. Our results suggest that because of their higher evolutionary rates, COI and H3 are not suitable in inferring phylogenetic relationship among families but were useful in identifying species (i.e., DNA barcoding). In contrast, the more conserved 18S rRNA gene was useful in confirming the integrity of the source DNA samples (e.g. contamination) and was adequately informative for elucidating inter-family divergence, but not suitable for species identification. We also found intraspecific variations in COI sequences of some species (Fig. 2), that can be applicable to characterizing the genetic structures of populations. The maximum intraspecific variation seen in and Drunella basalis was 4.9% and 3.3%, respectively. This may suggest that cryptic species exist within these species. In conclusion, we collected DNA samples of 80 taxa of Ephemeroptera, covering ca. 60% of mayfly species in Japan. We analyzed COI, histone H3, and 18S rRNA sequences with 39, 46, and 61 species, respectively, which were morphologically identified. Our results indicated that COI, histone H3 gene sequences could serve as markers for species identification, whereas more conserved 18S rRNA gene could serve a marker for quality control of DNA samples. Sequence data presented in this study would also contribute to the population genetics studies by comparing the haplotype frequency of certain species in the future. DNA barcodes of Japanese mayflies Figure 1A. Phylogenetic trees of three genes reconstructed with nucleotide sequences. A, COI tree; B, histone H3 tree; C, 18S rRNA tree. Phylogenetic trees were reconstructed by the neighbor-joining method with sequence data of three genes (COI, H3, and 18S rRNA). The trees were rooted using outgroup sequences from Odonata. Species names were followed by the specimen IDs. Bootstrap reproducibility scores (50 %) were indicated at respective nodes. Specimen IDs marked with asterisk (*) indicates that a whole body was used for DNA extraction (i.e., unable to re-examine species morphologically). The V4 stem-loop region of 18S rRNA (corresponding to the position 650-788 of X89481, Misof et al. [5]) was trimmed from the sequence data in this phylogenetic analysis. K. Wakimura, et al. Figure 1B. Phylogenetic trees of three genes reconstructed with nucleotide sequences. A, COI tree; B, histone H3 tree; C, 18S rRNA tree. Phylogenetic trees were reconstructed by the neighbor-joining method with sequence data of three genes (COI, H3, and 18S rRNA). The trees were rooted using outgroup sequences from Odonata. Species names were followed by the specimen IDs. Bootstrap reproducibility scores (50 %) were indicated at respective nodes. Specimen IDs marked with asterisk (*) indicates that a whole body was used for DNA extraction (i.e., unable to re-examine species morphologically). The V4 stem-loop region of 18S rRNA (corresponding to the position 650-788 of X89481, Misof et al. [5]) was trimmed from the sequence data in this phylogenetic analysis. DNA barcodes of Japanese mayflies Figure 1C. Phylogenetic trees of three genes reconstructed with nucleotide sequences. A, COI tree; B, histone H3 tree; C, 18S rRNA tree. Phylogenetic trees were reconstructed by the neighbor-joining method with sequence data of three genes (COI, H3, and 18S rRNA). The trees were rooted using outgroup sequences from Odonata. Species names were followed by the specimen IDs. Bootstrap reproducibility scores (50 %) were indicated at respective nodes. Specimen IDs marked with asterisk (*) indicates that a whole body was used for DNA extraction (i.e., unable to re-examine species morphologically). The V4 stem-loop region of 18S rRNA (corresponding to the position 650-788 of X89481, Misof et al. [5]) was trimmed from the sequence data in this phylogenetic analysis. K. Wakimura, et al. Acknowledgements: The authors would like to thank Ms. Tamami Adachi for her help in DNA sequencing, Dr. Toshihito Fujitani for identification of some specimens belonging to Baetidae, and Tamagawakyo-wo-Mamorukai (Hashimoto City, Wakayama, Japan), a citizens' group working for nature studies and conservation, for their help and support in collecting mayfly samples in KiiNyugawa River. This work was partially supported by Water Resources Environment Technology Center (Grant Number 2008-04) and Ministry of Education, Culture, Sports, Science and Technology of Japan (MEXT KAKENHI Grant Number 25289172). DNA barcodes of Japanese mayflies K. Wakimura, et al. DNA barcodes of Japanese mayflies K. Wakimura, et al. DNA barcodes of Japanese mayflies K. Wakimura, et al. DNA barcodes of Japanese mayflies Conflict of interest: Authors declare nothing to disclose.

Journal

DNA Barcodes – de Gruyter

Published: Apr 25, 2016

There are no references for this article.